Control of Diffeomorphisms and Densities Andrei A. Agrachev SISSA, Trieste, Italy and Steklov Mathematical Institute, Moscow, Russia e-mail: agrachev@sissa.it Consider a classical control system as it was defined by Pontryagin: x = f (x, u), x M , u U. (1) Assume that the state space M is a smooth manifold , the set of control parameters U is a closed subset of another smooth manifold , the righthand side f is ...

Еще в разделе: (Показать все результаты (>25) - pont2008.cmc.msu.ru/ )

... The American Medical Association - American Medical Association Complete Guide to Men's Health . ... Название: American Medical Association Complete Guide to Men's Health . Автор: The American Medical Association . ... This ambitious, 500-page book from the American Medical Association is a thorough guide for keeping a man's body healthy, making sense of his system, and understanding specific health concerns. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>18271) - lib.mexmat.ru/ )

• Rogers J.L. - The Complete Patent Book: Everything You Need to Obtain Your
• Smullyan R.M. - Recursion Theory for Metamathematics :: Электронная библиотека
• Stenstroem B. - Ring of quotients. Introduction to methods of ring theory ::

... On the basis of interdisciplinary approach (synthesis + physical experiment + theory + simulation) we aim to develop the new technology for formation of polymer fibers via the elongation of reversible polymer gels in the process of fiber spinning. ... to synthesize new copolymers with associative groups forming reversible gels and to study physical properties of these gels including the behavior in elongational flow; . ...

Еще в разделе: (Показать все результаты (>427) - polly.phys.msu.ru/ )

• Seminar in Polymer Physics

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>267) - astro.uni-altai.ru/ )

Single cell molecular toolkit for inducible resistance to complete desiccation Oleg Gusev1, Alexander Nesmelov1, Ruslan Deviatiarov1, Elena Shagimardanova1, Jun Okada2, Richard Coernette2, Maria Logacheva3, Alexei Penin3, Al Forrest4 and Takahiro Kikawada1, 1 2 3 4 2 Institute of Fundamental Biology and Medicine, Kazan Federal University, Russia National Institute of Agrobiological Sciences, Tsukuba, Japan Belozersky Research ...

Еще в разделе: (Показать все результаты (>340) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/131.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/241.pdf

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>135) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3114) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... Grants and contracts . ... Graphics Media lab is a leader in international cooperation among laboratories of Department of computational mathematics and cybernetics, Lomonosov Moscow State University. ... Grant RFBR 14-01-00849 "People detection, tracking and annotation in video streams". ... Contract ?Advanced video processing for various video applications?, ... Contract ?Energy efficient video transmission over wireless channel and advanced video processing for various video applications?, ...

Еще в разделе: (Показать все результаты (>162) - graphics.cs.msu.ru/ )

• The Microsoft Machine Learning and Intelligence School will take place in Saint
• Automatic building texture completion | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab

... Nonlinear Transient Bubble Oscillations . ... The investigation considers issues associated with transient regime of nonlinear bubble oscillations. The nonlinear response of a gas bubble to a low frequency pumping wave results in parametrically-generated shape oscillations above a well-defined threshold. This may be detected through insonification of the bubble by a high-frequency imaging wave, leading to the subharmonic and fundamental combinations frequency signals. ...

Еще в разделе: (Показать все результаты (>744) - acs366.phys.msu.su/ )

• Abstract (Invited)
• Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>47) - cdfe.sinp.msu.ru/ )

• CDFE => Team

-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash-completion-r1 git -2 elisp-common DESCRIPTION= Stores, retrieves, generates, and synchronizes passwords securely using gpg, pwgen, and git HOMEPAGE= http://www.passwordstore.org/ EGIT_REPO_URI= http:// git .zx2c4.com/password-store SLOT= 0 LICENSE= GPL-2 KEYWORDS= IUSE= + ...

Еще в разделе: (Показать все результаты (>19169) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/pass/pass-1.6.5.ebuild
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1545.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1545.txt

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>9848) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 40c086a41ca0 .hgignore

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>845) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron

... This study is based on the analysis of melt inclusions in minerals. ... The analysis of glasses from melt inclusions in hawaiites showed no more than 0.07 wt % F and Cl. The low content of H 2 O in the deep fluids is supported by the investigation of a gas phase in melt inclusions. The more evolved plumasitic trachytes inherit the enrichment of melts in CO 2 fluids, which were observed in fluid inclusions. ... Melt inclusions from the agpaitic trachytes and pantellerites also contain CO 2 . ...

Еще в разделе: (Показать все результаты (>765) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Lapin1.htm
• http://geo.web.ru/conf/alkaline/2009/Viladkar.htm
• http://phys.web.ru/pubd/2011/07/26/0001185487/confseismo2011_1_announce_eng.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Research laboratories . ... The renewable energy resources geography in Russia and the world. ... Laboratory relationship with research organizations, including international: Moscow Power Energy Institute , Oceanology Institute RAS, Russia s Institute for Rural Electrification RAS, United Institute for High Temperatures RAS, Governmental Energy Strategy Institute , Geography Institute RAS, Experimental Meteorology Institute , Governmental Research ... Renewable energy sources...

Еще в разделе: (Показать все результаты (>62) - eng.geogr.msu.ru/ )

• Department of Social-Economic Geography of Foreign Countries
• Department of Oceanology

Test data generation for core-level verification of FIFO cache memory" . Kornykhin E.V. The generation of cache initial state for microprocessor testing with the aid of test templates is considered. ... The initial state generation of the cache memory is performed by resolving the constraints composed for a test template. Keywords: FIFO, constraints, system functional testing, core-level verification, test templates . PostScript (in Russian) (591KB) . PDF (in Russian) (196KB) . ...

Еще в разделе: (Показать все результаты (>503) - num-meth.srcc.msu.ru/ )

• Adaptive unstructured mesh generation methods for hydrogeological problems
• "Generation of octree meshes with cut cells in multiple material domains"
• "Calculation of optimal coefficients for quadrature formulas by the complete

... Fortran . Storage rules Dummy argument is a quantity in the specification of a procedure, function or subroutine. Actual argument is a quantity in the call of a procedure, function or subroutine. ... Becomes 101 END PROGRAM EXAMPLE SUBROUTINE SUB(X, Y, Z) IMPLICIT NONE REAL, INTENT(IN) :: X REAL, INTENT(INOUT) :: Y REAL, INTENT(OUT) :: Z Y = Y**2 Z = X + Y END SUBROUTINE SUB In Fortran there is really only one kind of argument usage, called argument association. ...

Еще в разделе: (Показать все результаты (>15592) - crydee.sai.msu.ru/ )

• Crydee.sai.msu.(ru,su) Archive
• E.V.Kononovich
• Additional problems at the transition

... Status of the Institute . ... The International Society for the Study of Time . ... Helping researchers to understand the diverse implicit and explicit notions of 'time' that predominate in numerous scientific disciplines . ... The upkeep, management, support, enlargement, and improvement of the institute's virtual library: "Bibliokhronos" . The upkeep, management, support, enlargement, and improvement of the institute's catalogue of publications topically concerned with time studies . ...

Еще в разделе: (Показать все результаты (>599) - chronos.msu.ru/ )

• Laboratory-chair of modelling the natural references of time
• Library of Electronic Publications
• Proceedings of the Institute

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>169) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell