A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>110) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... about ANTARES . ... Division of electromagnetic processes and atomic nuclei interactions INP MSU . Division of General Nuclear Physics MSU . Participation of MSU in ANTARES collaboration . Since June, 2009 the group of the Lomonosov Moscow State University takes part in the project. Our group consists of young researchers of MSU Skobeltsyn Nuclear Physics Institute and Faculty of Physics. ... M. Anghinolfi, A. Afanas'ev, V. Kulikovskiy, E. Shirokov . ... MSU, Faculty of Physics, 2009. ...

Еще в разделе: (Показать все результаты (>15) - antares.sinp.msu.ru/ )

• ANTARES in MSU

... http://www.univ-lorraine.fr/ . We have long-time collaboration with scientists from Laboratoire de Physique Moleculaire et des Collisions, Institut de Chimie, Physique et des Materiaux. 14 joint papers were published so far. ... http://www.uclouvain.be/ . ... There were published about 10 joint papers on mathematical aspects of few-body scattering theory in the case of Coulomb potentials. ... http://www.phys.msu.ru/ . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>12) - lmmqsp.sinp.msu.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>74) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

Sergey B. Popov Research experience My research interests and activity are centered around two fields of astrophysics: star formation and evolution and physics of compact objects. My research work on the population synthesis of binary stars was done in the Department of Relativistic astrophysics under supervision of Prof. Lipunov. ... In the future I would like to work on the evolution of isolated and binary neutron stars, accreting isolated neutron stars and young neutron stars in SNRs. ...

Еще в разделе: (Показать все результаты (>208) - xray.sai.msu.ru/ )

• Information for Authors
• Case B: #tex2html_wrap_inline768#
• Wolf-Rayet and He stars (stage IV)

... Leipzig, 2000. ... Использование Интернета в Лейпцигском университете. Ключевые слова: Интернет в высшей школе. ... СТАТЬИ . Jodin B. Jingras Y. Impact of collaborative research on academic science // Science a. publ. policy . ... Vol. ... Ключевые слова: Связь университетов с промышленностью. ... 2001. ... США. ... Ключевые слова: Наука в университетах. ... 124 S. Научно-исследовательская работа Института мировой экономики университета в Киле. 2000 г. Ключевые слова: Наука в университетах. ...

Еще в разделе: (Показать все результаты (>110) - srcc.msu.ru/ )

• Leading scientific fellow Sergey Piskarev Ph.D.
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

Geant4 toolkit for simulation of HEP experiments V.Ivanchenko From name of Geant4 collaboration BINP, Novosibirsk, Russia & CERN, Geneve, Switzerland Outline Geant4 history Design and tools Geant4 physics June 2002 release Prospects for future June,24 ACAT-2002 V.Ivanchenko Geant4 2 History 90th: About 100 FORTRAN MC programs in the world. The most popular in HEP GEANT3. ...

Еще в разделе: (Показать все результаты (>50) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf
• http://acat02.sinp.msu.ru/presentations/ratnikova/01.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>213) - www.philol.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>113) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>5) - www.issp.ac.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>108) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>979) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Order Chiroptera
• Two sympatric phylogroups of the Asian badger Meles leucurus (Carnivora:

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>15) - mailybaev.imec.msu.ru/ )

... M.V.Lomonosov Moscow State University . ... Structure . ... Research Centers . ... Physicists from Moscow State Univ. in collaboration with researchers from IKI RAS first constructed a two-dimensional quasi-adiabatic model of a thin current sheet in the magnetotail based on its longitudinal inhomogeneity. ... Popov, D.C. Delcourt, A. A. Petrukovich, and L. M. Zelenyi, Antisunward structure of thin current sheets in the Earth's magnetotail: implications of quasi-adiabatic theory, J. Geophys. ...

Еще в разделе: (Показать все результаты (>137) - phys.msu.ru/ )

... Research . ... 1972 ? current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol?zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)?. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>11) - lcl.srcc.msu.ru/ )

... Рассказ о факультете . ... Семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching" . 1 октября на факультете состоялся научно-практический семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching". ... Dr. Bernard Shearer, Head of English First in Russia (based in Moscow): Overview of English First and discussion of the different initiatives for teaching a variety of populations (young learners, teenagers, government, Olympics, etc.) ...

Еще в разделе: (Показать все результаты (>43) - ffl.msu.ru/ )

• About Us
• International Students
• Иностранным гражданам

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>143) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Publications about flora
• Materials of A. Shipunov

arxiv:1002.4415 Ограничения на космологический сигнал от аннигиляции темной материи по данным Fermi-LAT об изотропном гамма-фоне (Constraints on Cosmological Dark Matter Annihilation from the Fermi-LAT Isotropic Diffuse Gamma-Ray Measurement) . Authors: The Fermi-LAT collaboration . arxiv:1002.3205 Обнаружение задержанного ГэВного излучения от короткого гамма-всплеска 081024B по данным Ферми (Fermi detection of delayed GeV emission from the short GRB 081024B) . ... Authors: B. Scott Gaudi ...

Еще в разделе: (Показать все результаты (>417) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0910.html
• http://xray.sai.msu.ru/~polar/sci_rev/1502.html
• http://xray.sai.msu.ru/~polar/sci_rev/1303.html