. Name . Last modified . Size . Description . Parent Directory . - . atom_1.mpeg . 2009-10-05 21:02 . 7.7M . atom_5.mpeg . 2009-10-05 21:36 . 7.7M . atom_10.mpeg . 2009-10-05 21:21 . 7.6M . Apache/2.4.10 (Debian) Server at angel.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>23) - angel.cs.msu.su/ )

• : Interface AttributeSet
• : Interface DimensionSet

... News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . Publications on Transient luminous events . ... all news . ... UHECR SINP MSU, 2015 . ...

Еще в разделе: (Показать все результаты (>11) - uhecr.sinp.msu.ru/ )

• TUS mirror quality tests, Istra-2013
• Photos

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4359) - cdfe.sinp.msu.ru/ )

• Wave function

... Each July we ::. to Turkey for a holiday. are going . ... He ::: quite different since we :: married. is/has got . ... What time:::tomorrow? . ... If you ::. careful with electricity, you might get a shock. don't . ... had got to get . ... There were too much . ... b) What do you use your computer for? . ... g) Do you see yourself as a computer geek ? ... But as a true technobimbo , I really hate the way computers get stuck, go wrong and generally fail to explain themselves in plain English. 4. ::::...

Еще в разделе: (Показать все результаты (>19) - www.eng.math.msu.su/ )

. Test system . Student identification Enter your own data: . Nic name: . Password: .

Еще в разделе: (Показать все результаты (>139) - www.philol.msu.ru/ )

• LangueDOC :: Movie

Schedule : Nonlinearity of Media and Structures, Nonlinear Testing . ... Guyer R. (invited) . ... Esipov I. B. Nonlinear Sound Wave Propagation in 2-D Hysteretic Medium . ... Berndt T. P. Simultaneous Probing of the Nonlinear Effect of a Plane Unbonded Interface on Incident Longitudinal and Shear Acoustic Waves as a Function of Amplitude and Pressure . ... R. E. (invited) . ... Korobov A. I. Influence of Internal Structure of Polycrystalline Copper on Its Nonlinear Elastic and Acoustic Properties . ...

Еще в разделе: (Показать все результаты (>63) - acs366.phys.msu.su/ )

• Nonlinearity of Media and Structures, Nonlinear Testing
• AUTHOR : Krohn N
• AUTHOR : Busse G

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>70) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>19) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/survey.pdf

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>63) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>104) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Monday test Leaf morphology Leaf anatomy Introduction to Botany. ... Shipunov BIOL 154.10 Monday test Leaf morphology Leaf anatomy Terminal characters Leaves in nature Submerged and floated leaves of Ondinea Shipunov BIOL 154.10 Monday test Leaf morphology Leaf anatomy Terminal characters Leaves in nature Leaf mosaic Distribution of ... Shipunov BIOL 154.10 ...

Еще в разделе: (Показать все результаты (>128) - herba.msu.ru/ )

• Systema Naturae
• Moscow State University, Geobotany dpt. - View Courses
• Moscow State University, Geobotany dpt. - View Staff

.

Еще в разделе: (Показать все результаты (>22) - www.chemport.ru/ )

• Дисульфиновый голубой VN 150, for surfactant tests, (мелкая уп.) -
• ГиаминR 1622, for surfactant tests, (мелкая уп.) - компании-поставщики этого
• Продукция ОАО 'ГалоПолимер' прошла испытания в Test America Laboratories -

. Posted by test 11 Sen 2006 19:12:31 . test . Attachment: test . Tratata Tratata 24/9/2006 ( 0) .

Еще в разделе: (Показать все результаты (>91) - www.fadr.msu.ru/ )

• Abstracts
• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD

Execution performance of NAS tests . The tables, presented below, contain information about sizes and performance of MPI-programs and DVM-programs for NAS tests. ... Performances of DVM-programs and MPI-programs are comparable. ... Second, MPI-versions of some tests use parallelization along two dimensions of processor grid, whereas DVM-versions of all tests are performed now only on a line of processors. ... RCC-cluster Pentium III/500 + SCI, . ... BT test execution times in seconds (class A) . ...

Еще в разделе: (Показать все результаты (>105) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4
• Lib-DVM. Interface description
• Performance of DVM-programs

... Second set contains blast hits of the contig or the chromosome search against protein database, for example, Uniref90. ... Hit color corresponds to reading frame in the contig, color intensity is grteater than intensities of exons. ... Reading frame of five blast hits in the third exon of gene g4 are different than exon's reading frame . Blast hits in gene g3 located on reverse strand do not match reading frames of the 1st and 3rd exons and overlap 1-2 and 2-3 introns . ...

Еще в разделе: (Показать все результаты (>5) - mouse.belozersky.msu.ru/ )

• S : rm_systems
• wLake algorithm description

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>66) - qi.phys.msu.ru/ )

• Sergei Kulik: List of major publications

new-mac ]] . ... Instructions for Installing CompHEP under OSX . ... Be aware, that Mac OS ix not Linux, installation of any GNU (or GNU-based) software can cause problems! ... go to Fink ( http://fink.sourceforge.net/ or any other GNU software repository), download the fink application and БЂњFink CommanderБЂќ, and then use this to download the binary files for: gfortran (fortran 77 compiler) . download the last version of the software from the comphep web site, http://comphep.sinp.msu.ru . ...

Еще в разделе: (Показать все результаты (>16) - comphep.sinp.msu.ru/ )

• download:main [CompHEP]

. Стенды для тестирования электроники HES.

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

• silicon detector laboratory

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...