Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>225) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

TES data processing aims to divide the total field into components and to cancel these, caused by geological noise. The interpretation is fulfilled firstly in 1D variant (in the frame of horizontally-layered model, with IPI-1D package), and then in 2D variant (with IE2DL package). ... This model can be corrected with the help of different transformations for better seeing position and form of the deep objects. ... Two different approaches to the interpretation of profile VES data are possible. ...

Еще в разделе: (Показать все результаты (>44) - geophys.geol.msu.ru/ )

• TES. Median algorithm

Annotation of degree work "Modeling of Raman Lasers based on phosphorus-doped silica fiber" of student Yakovlenko Natalia. Mathematical modeling of two two-cascaded Raman fiber lasers (1.061\1.235\1.478 mkm and 1.061\1.235\1.306 mkm) on phosphorus-doped silica fiber was developed in this work. ... The first laser (1.478 mkm) is interesting for pumping of erbium fiber amplifier, the second (1.306 mkm) is for research of some nonlinear effects in optical fiber on the quartz glass. ...

Еще в разделе: (Показать все результаты (>128) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Borisov_Ivanov_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Mitrofanov_Zheltikov_en.pdf
• Laboratory of solid-state lasers and coherent spectroscopy

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>113) - uneex.mithril.cs.msu.su/ )

• Index of /static/DocsKdeOrg_Kontact/kde3/ru/kdepim/kontact

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>132) - polly.phys.msu.ru/ )

• NATO Scientific & Environmental Affairs
• NATO Scientific Environmental Affairs
• About me

... More Reports . ... Vocal repertoire in the Dhole Cuon alpinus in captivity // In: Canid Biology and Conservation, An International Conference, Oxford. Three independent structural components form the dhole vocal repertoire: the low tonal, the high tonal, and the pulsed one. On the base of the occurrence of the components the dhole vocal repertoire was represented as consisting of three vocal classes with eleven call types. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>74) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>21) - curl.sai.msu.ru/ )

The PROBLEM of ELECTRON and SUPERLUMINAL SIGNALS V.P. Oleinik Monograph is published in "Nova Science Publishers, Inc. ... The electron as an open self- organizing system 1 1 1 1 1 1 Physical ideas and main results The model of open system Equations for the vortex and potential components of electromagnetic field The self- acting field of electron Interaction of the field of electron with vortex electromagnetic field Action of the system of interacting fields. ... Superluminal signals and STR 2- 9. ...

Еще в разделе: (Показать все результаты (>369) - chronos.msu.ru/ )

• Table 1
• Determination analysis as a method for diagnostics of ecosystem condition
• A. P. Levich

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>118) - www.fadr.msu.ru/ )

• Untitled
• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Главная Cотрудничество ILC of Bratislava ILCB laboratories Laboratory of Optical Diagnostics and Visualization Multichannel spectroscopy . One of the trends in the conventional spectroscopy lies in substituting CCD arrays and matrices for the single-channel detectors. ... The flexibility of the experimental arrangement is provided by optical waveguides and fibers. ... 2008 МЛЦ МГУ . ...

Еще в разделе: (Показать все результаты (>55) - ilc.phys.msu.ru/ )

• Setup for high-resolution luminescence spectroscopy
• CCD detectors
• Diagnostic appliances and setups for femtosecond spectroscopy

... Site-directed mutagenesis of cytochrome c: reactions with respiratory chain components and superoxide radical. ... Three forms of horse heart cytochrome c with specific substitutions of heme cleft surface located amino acid residues involved in specific interactions with ubiquinol:cytochrome c reductase (complex III) and cytochrome c oxidase (complex IV) were constructed, and their reactions with superoxide radical produced by NADH:ubiquinone reductase (complex I) were studied. ...

Еще в разделе: (Показать все результаты (>54) - biochem.bio.msu.ru/ )

• Reversibility of nucleoside diphosphate kinase solubilization from the surface
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

.

75. LangueDOC :: Movie

76. http://lve.sinp.msu.ru/~rud/Atlas/soft/configuration.log1

77. Background? Faculty of Bioengineering and Bioinformatics, MSU

78. RNA Kinetics: Theory

79. The Apache TPF Port

80. http://www.sai.msu.su/gcvs/gcvs/nl74/74nl_rem.txt