... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>87) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация

The laboratory is engaged in fabricating high-efficiency catalysts and working out model descriptions of kinetics and mechanisms of the processes which take place in chemical power sources. The electrochemical techniques of catalysts preparation aimed to obtaining microloadings of platinum metals are developed, and the approaches to the regulating of the quantity and dispersion of deposited metal (by means of varying the support type, deposition potential, electrolyte composition, etc) are found. ...

Еще в разделе: (Показать все результаты (>54) - electr003.chem.msu.ru/ )

• Pronkin Sergey Nikolayevich
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

South Pole - Aitken" Basin on the First Images of the Lunar Far-side V.I.Chikmachev and V.V.Shevchenko Sternberg State Astronomical Institute,Universitetskii pr. ... This is confirmed by the present-day images of the South - Aithen basin floor [see the scheme of the secondary ring structures of the South Pole - Aitken basin (Head, 1993)]. ... Lunar Impact Basins; New Data for the Western Limb and Far -Side (Orientale and South Pole - Aitken Basins) from the First Galileo Flyby, J.Geophys. ...

Еще в разделе: (Показать все результаты (>69) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf
• http://selena.sai.msu.ru/Symposium/maps.doc

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>6) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>258) - www.philol.msu.ru/ )

• FDSL-7.5 | Home
• FDSL-7.5 | Call for Papers

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

NAME dbmmanage - Create and update user authentication files in DBM format SYNOPSIS dbmmanage filename [ command ] [ username [ encpasswd ] ] DESCRIPTION dbmmanage is used to create and update the DBM format files used to store usernames and password for basic authentica- tion of HTTP users. Resources available from the httpd Apache web server can be restricted to just the users listed in the files created by dbmmanage. ... This manual page only lists the command line arguments. ...

Еще в разделе: (Показать все результаты (>75) - neptun.sai.msu.ru/ )

• Manual Page: htpasswd - Apache HTTP Server
• Apache module mod_autoindex
• Definitions of terms used to describe Apache modules

A good description of how to make transformations between the different coordinate systems can be found in a paper by M. A. Hapgood, "Space physics coordinate transformations: A user guide", in Planetary and Space Science, Vol. ... X = First point of Aries (Vernal Equinox, i.e. from Earth to the Sun in the first day of Spring) . Z = Earth's mean spin axis . ... T = (Omega x R) / | ... X = Earth-Sun Line . Z = Ecliptic North Pole . ... Z = North Pole of solar rotation axis . ...

Еще в разделе: (Показать все результаты (>194) - www.kosmofizika.ru/ )

• Index of /lazutin
• Science Technology: Ongoing Solar Activity
• Index of /ucheba

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>202) - wasp.phys.msu.ru/ )

• Software Developer - Студенческий форум Физфака МГУ

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>213) - site2010.sai.msu.ru/ )

• General information

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>30) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• MSU's HPC HISTORY | Moscow University Supercomputing Center

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>3) - tex.bog.msu.ru/ )

OldFonts' font package . ... The package includes several Russian book font families ('Academy', 'Latin', 'Elizabeth', 'Usual New' et al.) in both PS Type 1 and True Type form and additional files to use these fonts as well as 'Adobe Minion' and 'Palatino Linotype' font families with LaTeX. The package also contains few supplementary fonts. All fonts contain modern Russian characters as well as those used in the 19th century Russian writing. ... T2D encoding files by A.I.Lebedev: T2D . ...

Еще в разделе: (Показать все результаты (>10) - lizard.phys.msu.su/ )

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>50) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/konash/Slides_ACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/severyanov/Severyanov-poster.ps

EXPERIMENTAL STUDY ON MELTING PHASE RELATIONS AND DIAMOND FORMATION IN THE CARBONATE-RICH KIMBERLITE FROM MAJUAGAA, . ... Carbonate-rich hypabyssal kimberlites of the Majuagaa dyke, Maniitsoq , southern West Greenland could be roughly characterized as a mixture of olivine and ilmenite (or Ti-magnetite) xenocrysts with the carbonate-rich (calcite and dolomite) matrix [1]. ... Subtraction of olivine and ilmenite results in a composition, which is close to carbonatite rather than carbonate-silicate melt. ...

Еще в разделе: (Показать все результаты (>311) - geo.web.ru/ )

• http://geo.web.ru/COMPASS/geo.html
• Comagmat software
• Plechov's FOTOALBUM

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>17) - smdc.sinp.msu.ru/ )

• Coronas-F - Space monitoring data center

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>4) - bioinf.fbb.msu.ru/ )

• RNA Kinetics main page

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рег.: ... Рейтинг: 575 . Re: Хоккей ЧМ 2008 [ re: sWIN ] . 03.05.2008 15:15 . ... Re: Хоккей ЧМ 2008 [ re: Zigzag ] . ... Re: Хоккей ЧМ 2008 [ re: maratrus ] . ...

Еще в разделе: (Показать все результаты (>2146) - www.snto-msu.net/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• [JavaScript в Opera] помогите разобраться - Public forum of MSU united student
• Re: Новинки программного обеспечения - Public forum of MSU united student

The Fulbright Program in Russia is pleased to announce a new small-grants competition that is open to all Russian alumni of the J. William Fulbright or Hubert H. Humphrey programs. ... Small grants ranging from $100 to $1,000 will be awarded to support short-term projects that promote one of the competition's themes. ... Fulbright alumni who previously received an alumni small grant (in 2004, 2005, or 2006) are not eligible to apply for a grant in this competition. ...

Еще в разделе: (Показать все результаты (>54) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Central Eurasian Studies Society Sixth Annual Conference (2005)
• Institute of Civilization