... Форумы > Разное > Тема . ... Форумы Список тем Новая тема . ... Help to solve . Consider a classical solving problem with initial situation I={}, goal G={q,r} and actions a and b with Prec(a)={}, Add(a)={q}, Del(a)={}; Prec(b)={q}, Add(b)={r}, Del(b)={q}. Encode this planning problem with horizon n=1 (i.e. actions at tome t=0 only ) as a SAT problem and show its infeasibility following the steps of a SAT solver. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6565) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | MSc/PhD in Computer Science at Clemson
• MMOnline | Форумы | Разное | Программисты
• MMOnline | Форумы | Аспирантура | Аспирантура в Англии по машинному обучению

There are stopped jobs. You have started a job by issuing a command and have then "stopped" the command from executing and placed it in the background using the key sequence Ctrl-z . Start the job again by typing fg and pressing the <Return> key. Quit the job or wait until it has finished. Try to logout again. Example . If you have several stopped jobs, you will have to go through this procedure for each one before you are able to logout. Not login shell. ...

Еще в разделе: (Показать все результаты (>265) - comet.sai.msu.ru/ )

• More about the UNIX operating system
• Problems using the ftp program
• Problems linking files

... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>292) - ee-journal.spa.msu.ru/ )

Heavy-ion collisions in modified AdS spaces Pozdeeva E.O based on work I.Ya. ... Gubser, Klebanov, Polyakov, 9802109 Witten, 9802150 The gravitational shock wave in AdS 5 space is dual to ultrarelativistic heavy-ion in 4D space-time. ... DISCREPANCY The simple holographic model gives dN c h / d s 2/ 3 The mininal black hole entropy can be estimated by trapped surface area S S trapped =A trapped / 4G N The trapped surface is surface whose null normals all propagate inward. ...

Еще в разделе: (Показать все результаты (>199) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/nekrasov.pdf
• http://qfthep.sinp.msu.ru/talks/demidov_qfthep2010.pdf
• http://qfthep.sinp.msu.ru/talks/andrianov_qfthep2010.pdf

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>174) - www.pereplet.ru/ )

• News of Russian Science

... Program . ...

Еще в разделе: (Показать все результаты (>43) - pont2008.cmc.msu.ru/ )

• Optimal Control and Differential Games. Poster session Международная

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>62) - acoustics.phys.msu.ru/ )

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>601) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > M.Cs. in computer science and electronics
• Студенческий форум Физфака МГУ > DjVu problem
• Работа в Samsung - Студенческий форум Физфака МГУ

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>23) - dynamo.geol.msu.ru/ )

• Summaries of articles

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>25) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Staff

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>34) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the  two-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>37) - erg.biophys.msu.ru/ )

• comcon1 ERG Research Group: Лаборатория теоретической биофизики

... quantum optics - different types of the light interference, . ... Another branch of my activity covers the problem of biphoton interference (1997-). ... Also we developed the effective interferometric protocols to generate some specific quantum states of light (the Bell states) in the most common case: broad spectrum of the pump (in particular for the femtosecond laser), any type of phase-matching (either type-I or type-II), and arbitrary length of nonlinear crystals. ... QUANTUM TELEPORTER . ...

Еще в разделе: (Показать все результаты (>105) - qi.phys.msu.ru/ )

• Publications :: Quantum Information Laboratory

email: valery_bondarev@mail.ru) , , , - , , environmental problems, environmental sociology, human ecology, time-spatial structure of social phenomenon, urbanization, urban sociology . ... Time-spatial structure of social practices which arise because of given interrelations are determined. The utmost multiplicity of resolving of environmental problems is shown (by the example of complex social interrelations on urbanized areas). ...

Еще в разделе: (Показать все результаты (>111) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/4/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/1/09.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>82) - scon155.phys.msu.su/ )

• Theory of electronic properties of disordered semiconductors and systems with
• Physics of Semiconductors division: List of courses

... Next: Mechanical system of the Up: SPM Installation Previous: SPM Installation Contents Index . Figure 1.1: SPM Set-up. 1 - Microscope , 2 - DAC and ADC conversion unit, 3 - Stepper motor controller, 4 - DSP board, 5 - computers (left computer - server, right computer - remote user). ... ADC and DAC electronics joined with stepper motor controller in one case. ... Next: Mechanical system of the Up: SPM Installation Previous: SPM Installation Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>97) - www.spm.genebee.msu.ru/ )

• Image formation and processing methods

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>11) - fbm.msu.ru/ )

... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...

Еще в разделе: (Показать все результаты (>61) - vertebrata.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... It is shown that their chemical activity , crystal structure and other properties dramatically depend on fluorine atomic structure and on characteristics of chemical bonds in fluorides. ... 1886 F2 CaF2 ( ) . ... F (NaHF2 , KHF2 , NH4HF2 ґ ), (, HF H2O - 36° ), ( HF), : - HF + aq H+Їaq + F -Їaq + HF2 Їaq (HF)nF -Їaq, n = 2ґ4 , - KF + HF K+ + HF2 , - SbF5 + HF H2F+ + SbF6 , 3HF - HF2 + H2F+ ( ) .. ... CaF2 . ... 1986. ... BeF2 (), Al2O3 + Na3AlF6 (), () ZrF4 (HfF4) () K2ZrF6 (K2HfF6) (), K2TaF4 (). ...

Еще в разделе: (Показать все результаты (>25) - www.inorg.chem.msu.ru/ )

• Inorganic Chemistry Division