... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

• Index of /about_center/workplaces

pic] Program of humanitarian aid from Russia Rectors' Union (RRU) to South-Ossetia's Tibilov State University The first batch of humanitarian aid from RRU to South-Ossetia's Tibilov State University was dispatched to Vladikavkaz by Ministry of Emergencies' charter plane at August 27. It included 1612 classical textbooks and manuals, and a modern computer training-room, comprised of 34 units of equipment. ... September 16, another charter plane has delivered the second batch of humanitarian aid. ...

Еще в разделе: (Показать все результаты (>20) - www.rsr-online.ru/ )

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>112) - polly.phys.msu.ru/ )

• LCOptimizer Software
• NATO Scientific & Environmental Affairs
• NATO Scientific Environmental Affairs

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>267) - wasp.phys.msu.ru/ )

• Software Developer - Студенческий форум Физфака МГУ

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-102.pdf
• http://shamolin2.imec.msu.ru/art-112.pdf
• http://shamolin2.imec.msu.ru/art-98-1.pdf

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>114) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение толщины пластин

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>16) - smdc.sinp.msu.ru/ )

• Coronas-F - Space monitoring data center

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Invited speakers

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>5) - tex.bog.msu.ru/ )

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>28) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• APPLICATIONS: Mechanics | Moscow University Supercomputing Center
• AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features. From Mobile to

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>5) - psyberlink.flogiston.ru/ )

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>62) - www.prof.msu.ru/ )

• Small Grants for Russian Fulbright and Humphrey Alumni, Fall 2006
• Central Eurasian Studies Society Sixth Annual Conference (2005)
• Small grants projects that will be most likely to receive funding?

The laboratory is engaged in fabricating high-efficiency catalysts and working out model descriptions of kinetics and mechanisms of the processes which take place in chemical power sources. The electrochemical techniques of catalysts preparation aimed to obtaining microloadings of platinum metals are developed, and the approaches to the regulating of the quantity and dispersion of deposited metal (by means of varying the support type, deposition potential, electrolyte composition, etc) are found. ...

Еще в разделе: (Показать все результаты (>46) - electr003.chem.msu.ru/ )

• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage