news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

NONLINEAR OSCILLATIONS OF TWO COUPLED COMPLEMENTARY DNA BASES Yakushevich L. V., Gapa S.1, Awrejcewicz J. 1 1 Institute of Cell Biophysics of the Russian Academy of Sciences, Institutskaya str. ... In order to study the oscillations we develop and modify the recently proposed approach, and we apply it to study nonlinear oscillations of single DNA bases: Adenine (A), Thymine (T), Guanine (G) and Cytosine (C) (see [1]). ...

Еще в разделе: (Показать все результаты (>13889) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc61577/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc61585/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc184795/eng.pdf

Neural Par ticle Discrimination for Triggering Interesting Physics Channels with Calorimetry Data Є Є Andre Rabello dos ANJOS (Andre.Rabello@ufrj.br) and Jose Manoel de SEIXAS (seixas@lps.ufrj.br) LPS/COPPE/UFRJ Base Environment The ATLAS experiment System Design (1/2) Calorimeter Data for LVL2 System Design (2/2) Building rings.. ... The calorimeter data that are available for analysis at LVL2 are derived from superimposed fine-grained layers composed of particle energy samplers. ...

Еще в разделе: (Показать все результаты (>55) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/nikitin/posterACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/davydychev/acat2002.pdf
• http://acat02.sinp.msu.ru/presentations/gasthuber/presentation.tgif.pdf

Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...

Еще в разделе: (Показать все результаты (>159) - www.psy.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Senior IFP Fall 2005 . The Center on Philanthropy and Civil Society's Senior International Fellows Program provides an opportunity for the professional development of Third-Sector practitioners from outside the United States who are decision makers in their professions. The program is designed to help build Third-Sector capacity in the Fellows' home countries. ... The topic for the year 2005 will be community foundations . ...

Еще в разделе: (Показать все результаты (>483) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: International Fellows Program
• Клуб выпускников МГУ: Human Rights Watch: Девочки в американских тюрьмах
• Клуб выпускников МГУ: Обсуждение материала "Human Rights Watch: Девочки в

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>12) - www.edst.msu.ru/ )

... Design of small molecule antiviral compounds against tick-borne encephalitis, dengue fever, and other diseases caused by flaviviruses . ... K. N. Sedenkova, E. V. Dueva, E. B. Averina, Y. K. Grishin, D. I. Osolodkin, L. I. Kozlovskaya, V. A. Palyulin, E. N. Savelyev, B. S. Orlinson, I. A. Novakov, G. M. Butov, T. S. Kuznetsova, G. G. Karganova, N. S. Zefirov. Synthesis and Assessment of 4-Aminotetrahydroquinazoline Derivatives as Tick-Borne Encephalitis Virus Reproduction Inhibitors . ...

Еще в разделе: (Показать все результаты (>8) - qsar.chem.msu.ru/ )

• Cytokinin Receptors - Laboratory of Medicinal Chemistry
• Molecular switches - Laboratory of Medicinal Chemistry

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• IMISS-1 | Университетский спутник "Ломоносов"
• Publications | Университетский спутник "Ломоносов"

... Magnetoelastic Rayleigh Wave Convolver Based on Ga,Sc:YIG/GGG Structure . ... The characteristics of a surface magnetoelastic wave convolver based on a Ga, Sc Б.. substituted yttrium iron garnet ferrite film on a gadolinium gallium garnet substrate (Ga,Sc:YIG/GGG) were experimentally studied. The magnetic film was 30-60 microns thick with saturation magnetization of 200-300 G. Surface Rayleigh acoustic waves were excited in Ga,Sc:YIG/GGG using a bridge scheme. ...

Еще в разделе: (Показать все результаты (>156) - acs366.phys.msu.su/ )

• Abstract (Invited)

... 2013 . ... Publications . ... 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 . ... Vetchanin E. V. , Tenenev V. A. , Shaura A. S. Motion control of a rigid body in viscous fluid . ... Vetchanin E. V., Tenenev V. A., Shaura A. S., Motion control of a rigid body in viscous fluid, Computer Research and Modeling, 2013, vol. 5, no. 4, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>216) - ics.org.ru/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. November 19, 1999 . Mercury And The Sun . ... TRACE Project . Explanation: Just days before the peak of the Leonid meteor shower , skywatchers were offered another astronomical treat as planet Mercury crossed the face of the Sun on November 15. Viewed from planet Earth, a transit of Mercury is not all that rare. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: October 2, 1999 - Phi Persei: Double Star
• APOD: November 5, 1997 - The Milky Way's Gamma-Ray Halo
• APOD: July 8, 1999 - Eruptive Prominence

Complexification as alternative to higher dimensions: N = 2 string as a complex source of Kerr geometry. ... Based on: A.B., Stringlike structures in the Kerr-Schild geometry: N=2 string, twistors and Calabi-Yau twofold [arXiv:1307.5021 ]. ... Complex shift of the Coulomb solution (x) in Cartesian coordinates x = (x, y , z ) Ta(x) = a(x + i~), where ~ = (0, 0, -ia), creates in the real slice Appel solution a = Re ~ ~a a in oblate spheroidal coordinates r and . ... Complex Kerr String. ...

Еще в разделе: (Показать все результаты (>217) - nuclphys.sinp.msu.ru/ )

• A.M.Baldin
• Left to right: A.M.Baldin, V.P.Dzelepov, M.Savinsky (Poland), G.N.Flerov.
• Left to right: A.M.Baldin, S.S.Gershtein, A.N.Gorbunov, E.I.Tamm, and Yu.M.Ado.

... id #1550 . Journal of Immune Based Therapies and Vaccines [J Immun Based Therap Vaccin] . Common information . ... no information] . ... 1476-8518 . ... since 2003-01-01 till today . ... FREE electronic journal! ... http://www.jibtherapies.com/home/ . ... today . ...

Еще в разделе: (Показать все результаты (>51) - journals.genebee.msu.ru/ )

. There are many other mail programs available for UNIX systems. Check with your system administrator to see if any of them are available on this system. Here are a selection of the most popular UNIX mailers: . Elm - screen based mailer . Pine - menu based mailer .

Еще в разделе: (Показать все результаты (>122) - comet.sai.msu.ru/ )

• Models recipes
• Figure Overlays
• Network domains and mail addresses

... Полная версия этой страницы: [NEW!] Аспирантура во Франции . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . Natasha . ... Обычно даже 2000 евро (чистыми) уже считаются неплохой аспирантской зарплатой, а тут ставка по уровню финансирования больше похоже на постдокторскую. ... Дальше есть еще налоги, которые вы будете платить каждый год, заполняя декларацию. ... Есть еще страховка медицинская, чуть лучше самой плохой - это еще 100 евро в год. ... Здравствуйте, Natasha. ...

Еще в разделе: (Показать все результаты (>780) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > MSc/PhD positions in the Optical Sensors for
• Студенческий форум Физфака МГУ > Accountant (Accounts Payable)
• Студенческий форум Физфака МГУ > нужны статьи из Nuclear Phys. B

... Speech Recognition Engine 2.0 is a Windows-9x based computer program, allowing a User to utilize a multi-sensor setup consisting of several acoustic microphones, breath-sensor and lips movement detection sensor. ... The User can simply produce new spectral parameters dynamically calculated and saved in special cycled buffers called "channels". ... It is possible to produce special "speech detection" spectral channels using "speech detection" unary operation. ...

Еще в разделе: (Показать все результаты (>124) - www.intsys.msu.ru/ )

• Intelligent Systems :: Science :: Conference
• Intelligent Systems :: Staff :: Zhuk Dmitriy
• Intelligent Systems :: Staff :: Zolotykh Andrej Alexeevich

... Geology and geochemistry of ore deposits . ... The Head of the Chair, Professor N.V.Koronovsky The Chair trains students in two areas of specialization: (1) Geotectonics and (2) Geological Survey and Prospecting of Mineral Deposits. ... Members of the Chair give lectures on General Geology to students not only of the Faculty of Geology but also those of the Faculty of Geography and the Faculty of Soil Science. They provide students with field training in the Crimea and Moscow region. ...

Еще в разделе: (Показать все результаты (>83) - www.geol.msu.ru/ )

• Department of Lithology and Marine Geology - Generale Information

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>157) - ffl.msu.ru/ )

• Наш факультет