THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>10) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... UDC 577.213:577.217 Similar Features in the Mechanisms of mRNA Translation Initiation in Eukaryotic and Prokaryotic Systems D. E. Andreev, I. M. Terenin, S. E. Dmitriev, and I. N. Shatsky Belozersky Institute of Physicochemical ... 119992 Russia; e-mail: shatsky@libro.genebee.msu.su Received February 20, 2006 Abstract--Similar features in the mechanisms of mRNA translation initiation on prokaryotic and ... Circularization of mRNA by eukaryotic translation initiation factors. ...

Еще в разделе: (Показать все результаты (>162) - www.genebee.msu.ru/ )

• http://www.genebee.msu.ru/LPSR/Pisarev_JVi2004.pdf
• http://www.genebee.msu.ru/LPSR/Zolotukhin_MCB2003.pdf
• http://www.genebee.msu.ru/anb/TKACHUK.DEP/D15.HTM

... Two Russian and Ukrainian ivy species: Hedera helix and H. colchica were investigated for clarifying which metric leaf characters are most suitable for distinguishing these species in fieldwork conditions. Multivariate visualisation methods (like principal component analysis and classification trees) show that most perspective characters are lengths of the leaf ``diagonal'', petiole and internode. Crimean (``Hedera taurica'') populations do not differ significantly from Caucasian H. helix. ...

Еще в разделе: (Показать все результаты (>195) - herba.msu.ru/ )

• Systema Naturae
• ALGAE AND THEIR CHANGES OVER TIME
• New Page 1

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>86) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>18) - curl.sai.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Аниме новинки [ re: Kai ] . ... Re: Аниме новинки [ re: gizm0 ] . ... Re: Аниме новинки [ re: bmv ] . ... Re: Аниме новинки [ re: Rad ] . ... Re: Аниме новинки [ re: blind ] ...

Еще в разделе: (Показать все результаты (>1558) - www.snto-msu.net/ )

• Re: Salami Fighting Association! - Public forum of MSU united student networks
• Детализация рейтинга: another - Public forum of MSU united student networks
• [Английский] Как сказать.. - Public forum of MSU united student networks

... Professor Yurii Naumovich Lipsky oversaw the preparation of the first ever maps of the far side of the Moon, of the whole Moon, and cartographic globes of the Moon. ... He was a professor, a doctor of physico-mathematical sciences, the founder of the Department of Lunar and Planetary Physics in GAISh and its first head. ... The first photographs of the far side of the Moon . ... He was the scientific supervisor of the study of the first photographs of the far side of the Moon. ...

Еще в разделе: (Показать все результаты (>87) - selena.sai.msu.ru/ )

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>90) - www.mgubs.ru/ )

• Директор York Associates провел семинар для магистров ВШБ МГУ
• Высшая школа бизнеса МГУ им. Ломоносова

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>4) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . которая состоится 7-8 июня 2006 г. на базе . факультета иностранных языков и регионоведения . ... Дидактические принципы дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>13) - anazarenko.ffl.msu.ru/ )

... International Studies . ... Russian Language Program . ... Professor Svetlana Grigor evna Ter-Minasova is a leading foreign language specialist and teacher, who has built up a formidable international reputation. ... At present professor Svetlana Ter-Minasova is President of the Faculty of Foreign Languages and Area Studies at Lomonosov Moscow State University, Russia, and Professor Emeritus in the University. ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ...

Еще в разделе: (Показать все результаты (>69) - ffl.msu.ru/ )

... On the set of such bundles consider the following equivalence relation: A k m  B k r , there are vector bundles  k t ;  k v with bers C k t ; C k v ; respectively, such that A k m End( k t )  = B k r End( k v ): Then the k-primary component Br k (X) of the topological Brauer group Br(X) of X is the group of equivalence classes of this relation with respect to the operation induced by the tensor product of bundles. In my talk some generalization of this group will be introduced. ...

Еще в разделе: (Показать все результаты (>130) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/cobordisms-en.pdf
• http://higeom.math.msu.su/people/taras/TTC/slides/arzhantsev.pdf
• C*-algebras: Talks

... Gas­liquid exchanges (i.e. gas transfer: rapid-medium). ... Ni pgas pH pKa q Si SI t T V Xi Ysubstrate i,j fproduct,substrate i carbon content of component i component index (see appendix) inhibition function (various, see Table A2) process index (see appendix) acid-base rate constant for component i first order decay rate for biomass death gas ­ liquid transfer coefficient specific Monod maximum uptake rate acid-base equilibrium constant Henry's law coefficient ...

Еще в разделе: (Показать все результаты (>105) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/JEE00-12.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/aminoaromatics-kotova.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/UASB2006.pdf

Supernova 2000K in MCG +9-19-191 This page is devoted to information on Supernova 2000K in MCG +9-19-191 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the Supernova links web page. MCG +9-19-191 is a galaxy 200" NNE of NGC 3888 . ... It was found to be a type Ia found 13 +/- 3 days past maximum light. ... Puckett image . ... Discovery mirror . ...

Еще в разделе: (Показать все результаты (>133) - www.rochesterastronomy.org/ )

• Supernova 1999an in IC 755
• SN1989B in M66

... Next: Median filtering Up: Image formation and processing Previous: Average slope subtraction Contents Index . Figure 1.7: Averaging data . There is some noise component in every surface image. To reduce or remove this noise component height in every point can be changed to average height value of its closest neighborhood (see pic. 1.7 ). ... Next: Median filtering Up: Image formation and processing Previous: Average slope subtraction Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>48) - www.spm.genebee.msu.ru/ )

• DNA-surfactant complexes in organic media
• Olga's Main Page

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>6) - physcontrol.phys.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

100. http://lav01.sinp.msu.ru/~vlk/EyyubovaWPCF2014.pdf