... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...

Еще в разделе: (Показать все результаты (>11) - antares.sinp.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>15) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>264) - www.philol.msu.ru/ )

• Title: Russian Language Training via INTERNET. Internet-based educational
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>138) - www.fadr.msu.ru/ )

• THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION
• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>57) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>8) - hea.phys.msu.su/ )

• Call for Papers

... The studied sample is a coarse-grained fluorite carbonatite of the second type composed of carbonate (~ 60 vol %), fluorite (~ 30%), K-feldspar (~ 5%), pyrite (2-3%), and barite (up to 1-2%). Carbonate is represented by calcite with elevated contents of љ Mn љ and FeO. ... The primary melt inclusions and syngenetic crystalline inclusions were revealed in fluorite, K-feldspar, and pyrite from fluorite carbonatite. ... Fluoride minerals are represented by fluorite and villiaumite. ...

Еще в разделе: (Показать все результаты (>303) - geo.web.ru/ )

• http://geo.web.ru/conf/khitariada/1-2003/informbul-1_2003/planet-13e.pdf
• Calendar Converter
• Авторский сайт Владимира Мальцева - литература

... Next: Scanners Up: Importing Images from Other Previous: Importing Images from Other Contents Index . ... Video or press button . The window where it is possible to select the driver will appear. Select the driver and press OK button, then the window, showing the movie from the videocamera will appear. Next time when the Command Video is selected or the button is pressed, the driver selection window won't appear any more, and the movie will be seen in a window. ...

Еще в разделе: (Показать все результаты (>104) - www.spm.genebee.msu.ru/ )

• Changing file names during scanning
• Proteins and membranes
• Network configuration

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>5) - www.cmc-online.ru/ )

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>56) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/medvedeva/Article.doc
• http://acat02.sinp.msu.ru/plenary.html
• http://acat02.sinp.msu.ru/presentations/ratnikova/01.pdf

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>8) - lmmqsp.sinp.msu.ru/ )

... K an (abstract) simplicial complex on the set [m] = {1, . ... zm) D / j I K Define the moment-angle complex ZK = { BI Dm } It is invariant under the co ordinatewise action of the standard torus Tm = on Cm. 2 (z1, . ... Now assume K is the underlying complex of a complete simplicial fan (a starshap ed sphere). ... A fan = {1, . ... Manifolds ZK corresp onding to complete regular simplicial fans are total spaces of holomorphic principal bundles over toric varieties with fibre a complex torus. ...

Еще в разделе: (Показать все результаты (>135) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2013tianjin-talk.pdf
• http://higeom.math.msu.su/people/taras/TTC/slides/arzhantsev.pdf
• Publications of E.A.Morosova

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Аниме новинки [ re: Kai ] . ... Re: Аниме новинки [ re: gizm0 ] . ... Re: Аниме новинки [ re: bmv ] . ... Re: Аниме новинки [ re: Rad ] . ... Re: Аниме новинки [ re: blind ] ...

Еще в разделе: (Показать все результаты (>1473) - www.snto-msu.net/ )

• Re: Новинки программного обеспечения - Public forum of MSU united student
• Хоккей ЧМ 2008 - Public forum of MSU united student networks
• Delphi 8 AE for Microsoft .NET Framework Final - качать тут - Public forum of

... Под поясняющими фразами будем понимать слова, обороты или придаточные предложения, которые прерывают предложение какими-либо пояснениями или уточнениями. ... Поясняющие фразы всегда отделяются запятыми. ... Неограничивающая приложная фраза: . ... Если на поясняющих фразах делается ударение (подчеркивается их значимость для смысла предложения), то вместо запятых могут использоваться тире. ... Если на поясняющих фразах не следует делать ударение, то вместо тире могут использоваться скобки. ...

Еще в разделе: (Показать все результаты (>37) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. AMTSR_C. Транспонирование матриц
• БЧА НИВЦ МГУ. AMTSR_P. Транспонирование матриц
• БЧА НИВЦ МГУ. SF14R_C. Эллиптические функции, интегралы и связанные с ними

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>18) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/res2007eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/sv_ug.pdf
• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>8) - www.sciencepark.ru/ )

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>4) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

PIPELINES' STUDIES -- NEW PROBLEM FOR GEOPHYSICS. ... From the century's beginning many thousand kilometers of various pipes and cables were stacked in ground on depth up to 5-6 meters. ... On our opinion to these methods resistivity sounding (fig.2) and profiling, potential of cathodic protection study and pipe tracing with magnetic antenna should be added. ... At studies of horizontal magnetic field's component with the help of magnetic antenna, directed normally to a pipe axis, maximum Fig.3. ...

Еще в разделе: (Показать все результаты (>56) - geophys.geol.msu.ru/ )

• Anis. Page2

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>8) - mouse.belozersky.msu.ru/ )

• wLake algorithm description
• PLANdbAffy: probe-level annotation database for Affymetrix expression
• wLake program homepage