... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>2) - tukachev.flogiston.ru/ )

If you can see this, it means that the installation of the Russian Apache web server software on this system was successful. ... This page is here because the site administrator has changed the configuration of this web server. ... The Apache Software Foundation, which wrote the web server software this site administrator is using, has nothing to do with maintaining this site and cannot help resolve configuration issues. ... You are free to use the image below on an Apache-powered web server. ...

Еще в разделе: (Показать все результаты (>55) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache directives
• Definitions of terms used to describe Apache modules
• Apache modules

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>581) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>208) - uneex.lorien.cs.msu.su/ )

• Module Index - Apache HTTP Server
• Conditionals
• Real-World Package Building

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>62) - uneex.mithril.cs.msu.su/ )

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>23) - www.issp.ac.ru/ )

• Institutes of Chernogolovka
• High Education in ISSP PAS, Chernogolovka
• Pod-Moscowny Branch of Moscow University in Chernogolovka, Home page

Generale Information . ... Students . ... Scientific Work . ... Department of Lithology and Marine Geology unites two laboratories: Laboratory of Lithology and Facial Analysis and Laboratory of Marine Geology , there is a branch in Geological Institute of Russian Academy of Sciences . The training of the students is carried out on educational direction 011100 "Geology", the department lets out the bachelors and diplomaed experts in specializations 011104 "Lithology" and 011105 "Marine Geology". ...

Еще в разделе: (Показать все результаты (>57) - www.geol.msu.ru/ )

• MSU-Geological Faculty-Department of Paleontology
• Faculty of Geology >> Our adjunct Professors
• Faculty of Geology >> Geology at Moscow State University

... Расписание заседаний Десятого международного форума "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности". ... Институт проблем информационной безопасности МГУ имени М.В.Ломоносова начал подготовку к Десятому международному форуму "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности", который состоится 25-28 апреля 2016 года в г. Гармиш-Партенкирхен, Германия. ...

Еще в разделе: (Показать все результаты (>18) - iisi.msu.ru/ )

... в рамках регулярного семинара по проекту Живой камень: от минералогии к мифопоэтике состоится доклад Олеси Темиршиной . ... Приглашаются участники проекта, сотрудники Института, а также все желающие. 2-3 сентября, 10.30-13.45: 4 лекции по курсу 'История науки' РАШ РГГУ (м. Новослободская, центральный вход РГГУ, далее 5 корп., 7 подъезд, комната 105) . ... 6 сентября, 10:00 Специальная сессия Института мировой культуры Живой и мертвый камень и вокруг . ... Институт мировой культуры МГУ 2003-2014 . ...

Еще в разделе: (Показать все результаты (>21) - imk.msu.ru/ )

• Институт мировой культуры МГУ. Отдел лингвокультурной экологии
• Vyach. Vs. Ivanov. Institute of World Culture
• Ilya Yakubovich. Institute of World Culture

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>78) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: News
• Intelligent Systems :: Research :: :: Articles

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>67) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• PC GAMESS version 7.1 to version 7.1.5 update information

A preliminary study on molecular phylogeny of giant flying squirrels, genus Petaurista (Rodentia, Sciuridae) based on mitochondrial cytochrome b gene sequences. ... Evolution of the cytochrome b gene of the mammals // Journal of Molecular Evolution. ... Oshida T., Fujita Y., Lin L-K. Masuda R. 2001a. A preliminary note on phylogenetic position of the lesser giant flying squirrel Petaurista elegans in the genus Petaurista, inferred from mitochondrial cytochrome b gene sequence // Mammal Study. ...

Еще в разделе: (Показать все результаты (>1328) - zmmu.msu.ru/ )

• Global fossil bat records - abstract
• Order Chiroptera

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>95) - srcc.msu.ru/ )

• Leading scientific fellow Sergey Piskarev Ph.D.
• История НИВЦ
• Laboratory of Systems for Automated Image Processing

... VAK Russian Federation . Keldysh institute of applied mathematics . ... Unitied Institute of Physics of the Earth named for O.Yu. Schmidt see also another site of this Institute . ... Moscow Meriya . Institute of Nutrition of the Russian Academy of Medical Sciences . MSU, Physics Department . ... Skobeltsyn Institute of Nuclear Physics of MSU , see also another site . P.N.Lebedev Physical Institute Russian Academy of Sciences . ... M.V. Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

• Other Russian Universities and Institutes
• ASTROMETRY DEPARTMENT of SAI
• Kozyreva Sasha's Bookmarks

... Security is rarely employed. l Advantages of globus_io ґ Ease of use of security, socket options, QoS ґ Easier Win32 portability ґ Very similar to existing BSD socket calls March 25, 2002 Globus ToolkitTM Developer Tutorial : Communication 2 Approach l l Provide familiar socket and file abstractions Provide both synchronous and asynchronous versions of everything ґ Can easily write code that will not block ...

Еще в разделе: (Показать все результаты (>53) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-01-Introduction1.pdf
• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>28) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>184) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Phd positions at the Max-Planck Institute for
• MMOnline | Форумы | Первокурсникам | Си - полезная информация
• MMOnline | Форумы | Аспирантура

Quantum Chemistry in Studies of Elementary Stages of Enzymatic Catalysis Alexander Nemukhin Department of Chemistry M.V. Lomonosov Moscow State University Russian Federation N.M. Emanuel Institute of Biochemical Physics Russian Academy of Sciences The aim is to study mechanisms of chemical reactions in complex molecular environment by considering J. Phys. Chem. ... Chem., ... Modeling, 2005, 11, 503 Grigorenko B., Rogov A., Nemukhin A. // J. Phys. Chem. ...

Еще в разделе: (Показать все результаты (>14) - lcc.chem.msu.ru/ )