... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>73) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>60) - qi.phys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>57) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>12) - suny.msu.ru/ )

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>45) - chaos.phys.msu.ru/ )

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_2.pdf
• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>24) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>21) - www.cie.ru/ )

• Russian Teachers Training Programmes :: Academic Programmes :: CIE

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>56) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/news.html
• http://acat02.sinp.msu.ru/presentations/gasthuber/presentation.tgif.pdf
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf

... GeneBee . ... Supported by the Russian Foundation for Basic Research, grant 10-07-00685-a . ... Services . ... Some services of GeneBee are mirrored at the servers of Bri-shur project . ... Databanks screening . Sequence analysis . ... AliBee - Multiple alignment Release 3.0 . Pipeline Screening: Keyword -> Similarity . ... Screening by similarity Release 3.0 . ... Gene Expression Analysis . GEA - System for Gene Expression Analysis . ... GeneBee Group Collaboration Research . ...

Еще в разделе: (Показать все результаты (>166) - www.genebee.msu.ru/ )

• GeneBee
• OUTPUT
• screening by keywords

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>126) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4
• DVM-system. Installation guide. Version 3.60
• DVM-system. Installation guide. Version 3.82

A. M. PERELOMOV SOME COMMENTS TO THE PAPER A. V. BORISOV I. S. MAMAEV Department of Theoretical Mechanics MoscowStateUniversity,Vorob'ievy gory 119899 Moscow, Russia E-mail: borisov@uni.udm.ru Laboratory of Dynamical Chaos and Nonlinearity Udmurt State University Universitetskaya 1, 426034 Izhevsk, Russia E-mail: mamaev@uni.udm.ru between the geodesic ow on two-dimensional ellipsoid and a Hamiltonian system on algebra e(3) in the Clebsch case was rst indicated in 3]. ...

Еще в разделе: (Показать все результаты (>94) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/268/pu_58_1220.pdf

... Форумы > Преподаватели > Тема . ... А.Т. Фоменко . ... Ответить Цитировать . ... Intelligencer 9 (1987), no. 2, 3. http://www.emis.de:80/cgi-bin/zmen/ZMATH/en/quick.html?first=1&maxdocs=3&type=html&an=0960.01038&format=complete . ... http://hbar.phys.msu.su/gorm/fomenko.htm . ... The book cover states ``In this volume, the solution of the Plateau problem in the class of all manifolds with fixed boundary is given in detail.. ... http://hbar.phys.msu.su/gorm/fomenko/novikov2.htm . ...

Еще в разделе: (Показать все результаты (>156) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | День Победы, год 2007.
• MMOnline | Форумы | Первокурсникам | Си - полезная информация
• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>8) - acm.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>4) - bioinf.fbb.msu.ru/ )

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>140) - herba.msu.ru/ )

• Flowers: Diversity, Development and Evolution
• The Linnaean Collection of the Herbarium of Moscow State University: digital
• Complete flora of islands and lakes as a statistical hypothesis