... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... English] Филологи, объясните плиз про Present Continuous . ... Re: [English] Филологи, объясните плиз про Present Continuous [ re: Non_trivial ] . ...

Еще в разделе: (Показать все результаты (>1900) - www.snto-msu.net/ )

• Программисты шутят - Public forum of MSU united student networks
• behaviour vs behavior: подскажите, как правильно - Public forum of MSU united
• Вопрос по поступлению на PhD - Public forum of MSU united student networks

Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...

Еще в разделе: (Показать все результаты (>19) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации

A paper presented at the Round Table discussion on the problem "Regularities in Natural Language Dynamics" at Qualico-97, Chair of the round table discussion: Sheila Embleton] . Anatoliy A. Polikarpov . 1.There are some attempts to model Natural Language Lexical System change in time in quantitative aspect. ... This, naturally, presupposes arising of all basic lexical system regularities, i.e., regularities in macro-dynamics of the whole vocabulary of a language. ... POLIKARPOV A.A. [1976]. ...

Еще в разделе: (Показать все результаты (>59) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of
• MSU-LGCLL:: A.A.Polikarpov, V.J.Kurlov - Stylistics, Semantics, Grammar: an

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... ФГП 10 лет . ... Home breaking news Orfalea Center represented at ?Globalistics 2013? Congress in Moscow, Russia . ... The Faculty of Global Processes at Lomonosov Moscow State University hosted its 3rd International Scientific Congress ?GLOBALISTICS 2013? on October 23-25, 2013. ... Orfalea Center program director Victor Faessel attended the conference on behalf of the Orfalea Center and in his capacity as secretary of the Global Studies Consortium, of which Moscow State University is a member. ...

Еще в разделе: (Показать все результаты (>83) - fgp.msu.ru/ )

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |

... Submit your article . ... The article presents the results of an analysis of electoral behavior in the municipal areas and city districts of Zabaykalsky Krai. ... The differences in electoral behavior between various municipal formations are also analyzed in the article. ... Municipal units, territorial electoral behavior, cartographic method, statistical data analysis, correlation analysis, expert method. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>183) - ee-journal.spa.msu.ru/ )

A. V. BORISOV, I. S. MAMAEV, A. A. KILIN Institute of Computer Science Universitetskaya, 1 426034, Izhevsk, Russia E-mail: b orisov@rcd.ru E-mail: mamaev@rcd.ru E-mail: aka@rcd.ru DYNAMICS OF ROLLING DISK Received August 22, 2002 DOI: 10.1070/RD2003v008n02ABEH000237 In the paper we present the qualitative analysis of rolling motion without slipping of a homogeneous round disk on a horisontal plane. ... Let's consider a motion of the p oint of contact on a plane. ... Regular and Chaotic Dynamics. ...

Еще в разделе: (Показать все результаты (>127) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/972/RCD752.pdf
• http://ics.org.ru/upload/iblock/ac0/144-on-the-problem-of-motion-of-vortex-sources-on-a-plane-_ru.pdf
• http://ics.org.ru/upload/iblock/ecf/PHDK32.pdf

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>25) - www.kge.msu.ru/ )

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>25) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/Crimea/win_right~eng.html
• Textbooks - Dynamic Processes in Geology
• Summaries of articles

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>8) - www.sciencepark.ru/ )

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>20) - site2010.sai.msu.ru/ )

• Information
• Results of recent and ongoing site programs
• General information

... Statutes of ERC . Methodical Commissions of ERC . ... The Methodical Commissions of the MSU Nanotechnology Education and Research Center (ERC) are set up according to all the research specializations of ERC. The Methodical Commissions of ERC are collegial bodies that prepare education programs of ERC and programs for developing courseware and training materials. ... ERC participants may be mutually agreed with members of methodical commissions representing relevant faculties and chairs. ...

Еще в разделе: (Показать все результаты (>24) - nano.msu.ru/ )

• Dye-sensitized Solar Cells ? Materials and Interfaces | MSU Nanotechnology

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>66) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys-2001-11(12)-en.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/Laser-Phys-Lett-2004.pdf

Theoretical dimension of the current financial crisis. Jacques SAPIR Professor of Economics EHESS-Paris The present lecture explores the current financial crisis from its theoretical grounds and then expends to macroeconomics issues and economic policy implications. ... Lecture 1 The current financial crisis and its predecessor. The current financial crisis has been anticipated by the US Savings and Loans crisis, which exploded on the US mortgage market from 1990 to 1992 (Doc. ... Doc. ...

Еще в разделе: (Показать все результаты (>19) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipeliv_31012011.pdf
• http://www.mse-msu.ru/Ayvazyan_Introduction_to_the_textbook_on_econometrics.pdf

Cost and time schedule 10 Cost and time schedule In this chapter, a summar y of the complete project cost is given, the basic schedule from star t of construction until end of commissioning is discussed and the resulting budget profile over all phases of the project is described. ... 20 XFEL TDR.indb 620 12/10/2007 15:28:06 Cost and time schedule Figure 10.1.1 Breakdown of project construction cost (sum of capital investment and personnel cost) into the work package groups. ... Figure10.5.3 project. ...

Еще в разделе: (Показать все результаты (>167) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором

... What distinguishes Armenian from most other Indo-European languages is the unusually high proportion of early lexical borrowings. ... The first case is that of Urartean, a non-Indo-European language spoken during the first millennium BC in the mountains of Eastern Anatolia, roughly in the same area where Armenians lived up to 1915. ... The second one is the case of Parthian, an Indo-European Iranian language that was spoken in Northern Iran from around 300 BC to 300 AD. ...

Еще в разделе: (Показать все результаты (>20) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf

... Reconstruction of the Polarization States of a Biphoton Field Yu. ... 31, Moscow, 115409 Russia Received June 7, 2005 A method for reconstructing an arbitrary quantum state of an optical system in Hilbert space with dimension d = 4 is discussed. ... At present, nearly complete control has apparently been achieved over two-level optical systems-- polarization, spatial, and frequency states of single photons. ... 3 2005 RECONSTRUCTION OF THE POLARIZATION STATES 167 Fig. ...

Еще в разделе: (Показать все результаты (>121) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2010-nphoton-4-585.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETP_lett_05.pdf
• http://qi.phys.msu.ru/kulik/Papers/PRA42303.pdf

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>60) - www.geol.msu.ru/ )

• Faculty of Geology >> Our adjunct Professors
• Faculty of Geology >> Departments
• Page 3. Publications