EFFECT OF pH AND VFA ON H YDROLYSIS OF ORGANIC SOLID W ASTE By Adrie Veeken,1 Sergey Kalyuzhnyi,2 Heijo Scharff,3 and Bert Hamelers4 ABSTRACT: The anaerobic hydrolysis rate of organic solid waste was studied at fixed volatile fatty acid (VFA) concentrations ranging from 3 to 30 g COD/ L and fixed pH values between 5 and 7. ... In this way, it was possible to distinguish between the inhibitory effects of pH, total VFA, and undissociated VFA on anaerobic hydrolysis. ... VFA control. ...

Еще в разделе: (Показать все результаты (>138) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/vesprille_2005.pdf
• http://www.enzyme.chem.msu.ru/~tishkov/Publications/JBiotechnol_97_58_187.pdf
• http://www.enzyme.chem.msu.ru/ryabov/pdf/MC_99.pdf

MNRAS Advance Access published January 27, 2014 MNRAS (2014) doi:10.1093/mnras/stt2365 Decoupled gas kinematics in isolated S0 galaxies Ivan Yu. ... Seven of 12 galaxies have revealed the presence of extended ionized-gas discs whose rotation is mostly decoupled from the stellar kinematics. ... Isolated galaxies are such galaxies. ... Similarly, we have found the shock-like excitation of the emission-line gas in the inclined gaseous disc of S0 galaxy NGC 7743 (Katkov, Moiseev & Sil'chenko 2011). ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/203546.ps.gz
• http://sn.sai.msu.ru/~sil/preprints/leo3.pdf
• http://sn.sai.msu.ru/~sil/preprints/counter.pdf

... Departments . ... ms.cmc.msu.ru . ... The Department is focused on the study of mathematical models that consider statistical regularities in random factor effects. The current research is carried out in different probability theory and mathematical statistics areas of fundamental theoretical and practical importance, including limit theorems in the probability theory, asymptotic methods in mathematical statistics, theory and statistical analysis of random processes, and the queuing theory. ...

Еще в разделе: (Показать все результаты (>150) - en.cs.msu.ru/ )

• Department of Mathematical Statistics
• Research Laboratory of Computational Modeling Tools | CMC MSU
• Computer Graphics and Multimedia Lab | CMC MSU

... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>8) - lcc.chem.msu.ru/ )

... A11, 1393, doi:10.1029/2001JA005073, 2002 Statistical distributions of field-aligned electron events in the near-equatorial magnetosphere observed by the Low Energy Plasma Analyzer on CRRES G. A. Abel,1 A. N. Fazakerley, and A. D. Johnstone2 Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey, UK Received 27 August 2001; revised 26 April 2002; accepted 22 August 2002; published 22 November 2002. ... FIELD-ALIGNED ELECTRON EVENTS SMP 29 - 3 Figure 1. ...

Еще в разделе: (Показать все результаты (>246) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity
• Background: Coordinate systems and transformations

Supercomputer consortium of Russia's universities creation A G R E E M E N T Under this Agreement - Moscow State Lomonosov University, - Nizhny-Novgorod State Lobachevsky University, - Tomsk State University, - South-Urals State University, referred hereinafter as "the Parties", have defined their arrangements on creation of Supercomputer consortium of Russia's universities 1. ... The full official name of the entity in Russian language is: Supercomputer consortium of Russia's universities. ...

Еще в разделе: (Показать все результаты (>50) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/112.doc
• Structure
• KARAMURZOV BARASBI SULEIMANOVICH

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>96) - new.math.msu.su/ )

• Riutin Konstantin Sergeevich | Department: General Problems of Control. Faculty
• Kochurov Aleksandr Savelyevich | Department: General Problems of Control.
• Demidovich Vasiliy Borisovich | Department: General Problems of Control.

... Dahl's texts and dictionaries in the Web (in Russian) . ... Employees of the Laboratory . ... About Laboratory . ... Anatoly Anatol'evich Polikarpov - a head of the laboratory - professor of Russian Language Department [ click here for personal information ] . ... About the laboratory . ... Development of techniques of gathering and analysis of mistakes of foreigners in Russian speech (a series of works of 1985-1991 under the leadership of A.A.Polikarpov with principal assictance by O.V.Kukushkina);...

Еще в разделе: (Показать все результаты (>68) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect
• MSU-LGCLL:: A.A.Polikarpov, V.J.Kurlov - Stylistics, Semantics, Grammar: an

... News . ... 32-bit Microcontroller Programming . Microcontroller Control of Motors . Second-year students classes . ... Parallel Programming . ... Microcontroller Programming . ... Microcontroller-related . ... Serguey Elizarov . Serguey Zapunidi . ... Alexander Karabutov . ... Serguey Yakovlev . ... We sincerely wish you a Happy New Year and Merry Christmas! We hope that this year has been for you a year of new achievements. ... Happy New Year 2016! ... Hits . ... Written by Pavel . ...

Еще в разделе: (Показать все результаты (>71) - engineering.phys.msu.ru/ )

• Parallel Programming
• Introduction to Linux
• Microcontroller Programming

... Issues of the year 2011 . ... Phone: +7-911-218-0499 . E-mail: kirill.chistyakov@gmail.com . ... Phone: +7-921-331-4598 . ... Phone: +7-921-588-2929 . ... THE GLACIER COMPLEXES OF THE MOUNTAIN MASSIFS OF THE NORTH-WEST OF INNER ASIA AND THEIR DYNAMICS Abstract: . ... Key words: mountain glaciers, the North-East of Inner Asia, dynamics of the glacier complexes, development of the glacier systems . ... 117997 Moscow, Russia . ... SUB-REGIONAL GEO-ECOLOGICAL MODEL OF A NATURAL COMPLEX Abstract: . ...

Еще в разделе: (Показать все результаты (>345) - www.geogr.msu.ru/ )

• CONTENTS ?3 - 2011
• CONTENTS ?2 - 2009
• CONTENTS ? 1 - 2015

email: theory@socio.msu.ru) , , , , , , , the branch of sociology, the branch matrix of sociology, divergence, the crisis of divergence in sociology, general sociological theory, the structure of modern sociology, key concepts of sociology, the matter field of sociology , . Article is devoted to a critical analysis of the structure of modern Russian sociology, which determines the increased attention to the development of branch sociological disciplines. ...

Еще в разделе: (Показать все результаты (>112) - vestnik.socio.msu.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Type of field courses . ... Specialists of the same profile graduate from the branches of the Faculty, located in Sevastopol (Ukraine) and Astana (Kazakhstan). ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Administration

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>109) - hbar.phys.msu.ru/ )

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>12) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/genome_biol_evol_2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/insilicobiol_2003.pdf

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>160) - www.pereplet.ru/ )

Psychology in Russia: State of the Art · 2009 Personality and self-regulation as determinants of rational decision making in a Politic al voting situation Tatiana A. Indina, Varvara I. Morosanova Psychologial Institute of Russian Academy of Education Moscow The association of self-regulation and personality factors with rational decision making was investigated using an experimental model of political voting. ... On the other hand, emotional intensiveness negatively affects rational decision making. ...

Еще в разделе: (Показать все результаты (>185) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/izmailov/2008-izmailov_zimachev.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/filipieva.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/nazarov.pdf

... 2013 . ... Staff . ... 2006 2010: Head of the Department of Information Technologies and Computer Engineering of the Department Т?Mechatronic systemsТЛ at ISTU. since 2013: Associate Professor of the Department of Theoretical Physics at Udmurt State University; Associate Professor of the Department Т?Higher mathematicsТЛ at M.T. Kalashnikov Izhevsk State Technical University. since 2013: Junior Researcher of the Laboratory of Nonlinear Analysis and the Design of New Types of Vehicles at UdSU. ...

Еще в разделе: (Показать все результаты (>125) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Ivanova Tatyana Borisovna
• Institute of Computer Sciences - Staff
• Institute of Computer Sciences - Staff - Kilin Alexander Alexandrovich

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>17) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php
• SWX - Главная