. Skip to main content . You are not logged in. ( Login ) . Information and Communication Technologies is a supporting on-line course aimed at improving students' knowledge aboutљRussia and the ability to convey it by means of a target language . Управляющий: Lyudmila Georgievna Sizykh . Управляющий: Victoria Alexandrovna Skakunova . Управляющий: Людмила Георгиевна Сизых . Управляющий: Виктория Александровна Фадеева .

Еще в разделе: (Показать все результаты (>10563) - moodle.ffl.msu.ru/ )

... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

• Master program "Mathematical and computer methods of image processing" |
• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |

... Geography of World Economy . ... Recreational Geography and International Tourism . ... World Data Systems functions under the sponsorship of the International Council for Science ICSU since 1956 (until 2008 in the form of two structures - World Data Centers and the Federation of Astronomical and Geophysical Data Analysis Services). ... Map "The population of the Russian Federation", scale 1:7 500 000, Russian Geographical Society, Faculty of Geography Moscow State University, OOO "FOC", 2014. ...

Еще в разделе: (Показать все результаты (>50) - eng.geogr.msu.ru/ )

• Undergraduate study
• Department of Land Hydrology
• International cooperation

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Alexander Pozdneev at the ASMS 2008 Conference | Department of the Automation
• Alexander Pozdneev at the ASMS 2008 Conference

Research paper Struct Multidisc Optim 27, 435 ­ 445 (2004) DOI 10.1007/s00158-004-0388-x Optimal shapes of parametrically excited beams A.A. Mailybaev, H. Yabuno, and H. Kaneko Abstract Straight elastically supported beams of variable width under the action of a periodic axial force are considered. Two shape optimization problems for reducing parametric resonance zones are studied. In the first problem, the minimal (critical) amplitude of the excitation force is maximized. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/reviews/Olhoff.pdf
• Multiparameter Stability Theory with Mechanical Applications

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>4) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... contact ERC . ... Professor, Faculty of Physics, MSU . Head, Chair of Polymer and Crystal Physics, Faculty of Physics, MSU, and Laboratory of Physical Chemistry of Polymers, INEOS, RAS . ... Researcher, Chair of Polymer and Crystal Physics, Faculty of Physics, MSU . ... Head, Inorganic Crystal Chemistry Laboratory, Chair of Inorganic Chemistry, Faculty of Chemistry, MSU . Head, Laboratory of Fundamental Research into Aluminium Reduction Technology, Faculty of Chemistry, MSU and RUSAL . ...

Еще в разделе: (Показать все результаты (>35) - nano.msu.ru/ )

• Contact ERC | Научно-образовательный центр по нанотехнологиям МГУ
• Announcement about the admission to MSU Graduate School for a new Master?s

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>55) - acoustics.phys.msu.ru/ )

International Laser Center of MSU . ... News . ... Moscow Vyatichi, November 9 - 11, 2009. ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Joint Taiwan Russian Symposium "Nonlinear Optics and Photonics" . ... Venue of the symposium: Nonlinear Optics Building, Leninskie gory, Moscow, Russia . The main topics of the Joint Taiwan Russian Symposium are: . ... Symposium is Organized by International Laser Center and Physics Department of M.V. Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>727) - ilc.phys.msu.ru/ )

• Continuing Education and Retraining Program
• IV International Symposium Modern Problems of Laser Physics MPLP'2004
• Laboratory of theoretical problems in optics

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>29) - hit-conf.imec.msu.ru/ )

Cameras · ­ · · · · · · · · ! MATLAB · MATLAB · Let's design a camera Idea 1: put a piece of film in front of an object Do we get a reasonable image? ... Slide by Steve Seitz Shrinking the aperture Adding a lens A lens focuses light onto the film · Thin lens model: ­ Rays passing through the center are not deviated (pinhole projection model still holds) Slide by Steve Seitz Adding a lens focal point f A lens focuses light onto the film · Thin ...

Еще в разделе: (Показать все результаты (>17) - imaging.cs.msu.ru/ )

• Imaging lab: people

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Keldysh Institute of Applied Mathematics of RAS . DRIVER: 3D numerical modelling of high energy density plasma physics . ... AREA: Plasma Physics . ... IMPACT: The expected results of numerical experiments will help to explain the observed statistical characteristics of molecular hydrogen clouds in external galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>51) - hpc.msu.ru/ )

• Octoshell: Lightweight and Innovative Cluster Management System | Moscow
• APPLICATIONS: Mathematics | Moscow University Supercomputing Center
• APPLICATIONS: Theoretical Physics | Moscow University Supercomputing Center

МГУ имени М.В.Ломоносова Русская версия . ... About Conference . ... Asian and African Studies . ... Public and Municipal Administration . Public audit . ... Art Criticism and History . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... We invite to participation in the conference and in our scientific community everybody who is interested in current issues of government control (audit). ... Public audit: the issues of public finance . ...

Еще в разделе: (Показать все результаты (>15) - conf.msu.ru/ )

Invited talk Session 1C-4, 17:50h Ultrafast magnetophotonics and magnetoplasmonics A.Yu. ... One of the most prominent opportunities of using SPP nanostructures is to shape femtosecond laser pulses. ... External magnetization of the magnetoplasmonic crystal induces temporal modulation of 200 fs laser pulses when the SPP resonance is tuned across the spectral range of the femtosecond pulse being used. ...

Еще в разделе: (Показать все результаты (>60) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jap113_17a942_2013.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jmmm2015.pdf
• http://nanolab.phys.msu.ru/sites/default/files/optexp20_10538_2012.pdf

... Главная . ... Контакты . ... Ленинские горы, дом 1, строение 12 . Москва, почтовый индекс 119991 . ... Телефон: +7(495) 987 65 21 . Факс: +7(495) 987 65 21 . ... Ленинские горы, дом 1, . ... 7 (495) 939-10-00 . ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>15) - anazarenko.ffl.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

• Alexander Pozdneev at the ASMS 2008 Conference

ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...

Еще в разделе: (Показать все результаты (>19) - antares.sinp.msu.ru/ )

. Помощь - Поиск - Пользователи - Календарь . Полная версия: Пост прозрения . Грация-МГУ::Форум > Общение > Общение . O'Rey . Dec 21 2009, 01:49 . Эппл открывает нам глаза: . http://support.apple.com/kb/HT2300 . Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда .

Еще в разделе: (Показать все результаты (>27) - grace.msu.ru/ )

• Пост прозрения - Грация-МГУ::Форум
• Грация-МГУ::Форум > Attention, please!
• Attention, please! - Грация-МГУ::Форум