... Printed in the UK PII: S0305-4470(00)12866-5 Properties of some chaotic billiards with time-dependent boundaries A Loskutov, A B Ryabov and L G Akinshin Physics Faculty, Moscow State University, Moscow 119899, Russia Received 28 March 2000, in final form 25 July 2000 Abstract. ... It is shown that in all cases billiard particles can reach unbounded velocities. Average velocities of the particle ensemble as functions of time and the number of collisions are obtained. ...

Еще в разделе: (Показать все результаты (>58) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/IJBC_thermodyn_bill.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JETP_Bill_1999.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/IJBC_3body_problem.pdf

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

... Departments . ... Knizhnikov Y.F. (aerospace stereo modeling, remote sensing), Doctor of Geography; . ... Advanced research is in the field of further development and integration of geographic cartography theory and methods, geoinformatics and remote sensing; the use of satellite and aircraft monitoring in geography and cartography; creating regional and local GIS; WEB- mapping; satellite positioning systems; the development of geographic information and online technologies, thematical geoportals. ...

Еще в разделе: (Показать все результаты (>107) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Science
• Undergraduate study

... Statutes of ERC . Methodical Commissions of ERC . ... The Methodical Commissions of the MSU Nanotechnology Education and Research Center (ERC) are set up according to all the research specializations of ERC. The Methodical Commissions of ERC are collegial bodies that prepare education programs of ERC and programs for developing courseware and training materials. ... ERC participants may be mutually agreed with members of methodical commissions representing relevant faculties and chairs. ...

Еще в разделе: (Показать все результаты (>14) - nano.msu.ru/ )

• Announcement about the admission to MSU Graduate School for a new Master?s
• Composite Nanomaterials Master?s Program | MSU Nanotechnology Education and

... Most of us spend a good part of our lives working in organizations, either as employees or managers, or both.љ The chief purpose of this courseљљ is to provide you with theoretical insights, practical skills, and ethical standards of the discipline of management with a focus on information management and human resources.љ The course is focused on people in organizations and their interactions.љ ... Администратор : Mira Bergelson . Преподаватель: Mira Bergelson . ...

Еще в разделе: (Показать все результаты (>10564) - moodle.ffl.msu.ru/ )

• Moodle ФИЯР МГУ
• moodle: Integrated course
• Forgotten password

Инвест-диагностика . ... Технология . Программные средства . ... ДИМО' > Программные средства > Программа Техномаркет > 1. Структура и интерфейс программы . Программа Планер . ... Программа состоит из 4-х модулей: COMP, MANAGER, SHELL, NET . ... Модуль, отвечающий за вычислительную часть программы . Модуль, отвечающий за создание и поддержание структуры рынка (добавление, удаление фирм, задание начальных данных и т.д.) . ... Модуль COMP отвечает за вычислительную часть программы. ...

Еще в разделе: (Показать все результаты (>4) - oc.cs.msu.su/ )

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>4) - lab106.imec.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>4) - mph.cmc.msu.ru/ )

479 (2012) 183-185 Contents lists available at SciVerse ScienceDirect Physica C journal h omepage: www.else vier.com/locate/physc Near-field optical microscopy of plasmonic effects in anisotropic metamaterials M.R. Shcherbakov a,, B.B. Tsema a b c a,b , Yu.B. Tsema a, A.A. Ezhov a, V.I. Panov a, D.P Absolute measurements of near-field linear dichroism are performed for an array of plasmonic nanowires by measuring the linear dichroism value at the edge of the sample. ... 1о? aei/ ?b0 sin h ? ...

Еще в разделе: (Показать все результаты (>55) - nanolab.phys.msu.ru/ )

• Ultrafast magnetophotonics | Laboratory of Nanophotonics & Metamaterials
• Students can now use the homework download system and track their current

... A Model for the Interaction of Plane Waves with Nonlinear Interfaces . ... Cracks generated by fatigue or stress corrosion processes tend to have faces which conform to each other at the scale defined by the grain size. Thus, even a small compressive stress suffices to bring the surfaces in close contact, and dramatically changes the linear response of the defect to an incident ultrasonic wave. ... Three mechanisms responsible for the nonlinear behaviour of the interface are discussed. ...

Еще в разделе: (Показать все результаты (>86) - acs366.phys.msu.su/ )

• Abstract (Invited)

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations

... Preliminary evaluation of forest ecosystems' state near the smelter was made, the monitoring methodology for polluted areas was developed, and critical loads of acid deposition were assessed (see also soil.msu.ru/projects/acidification/ ). ... The new built up database on forest ecosystem data for permanent monitoring plots was used for analysis of soil chemical state in forest ecosystems subjected to airborne pollution in the fragile boreal environment in the Norwegian-Russian border area. ...

Еще в разделе: (Показать все результаты (>18) - eco.soil.msu.ru/ )

• Effects of Natural Soil Acidification on Biodiversity in Boreal Forest

University Satellites and . Space Science Education . ... BAUMANENTS spacecraft which was developed by Bauman Moscow State Technical University in association with Federal Unitary Enterprise NPO Mashinostroenie has on board a set of instrumentation for conducting scientific experiments including satellite modem Qualcomm GSP 1620. ... Within additional experiment which will be conducted if possible, information coming from the modem will be used to define orbit parameters of the satellite. ...

Еще в разделе: (Показать все результаты (>67) - cosmos.msu.ru/ )

• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,
• Space Scientific and Education project of Lomonosov Moscow State University

... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys-2001-11(10)-en.pdf
• http://qilab.phys.msu.ru/papers/lpl-sych-2005.pdf
• http://qilab.phys.msu.ru/papers/PhysRevA_70_052331.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf

... An Analysis of Modern Discrete Movements of the Earth's Crustal Blocks in Geodynamically Active Regions Based on GPS Data V. S. Zakharov and D. A. Simonov Moscow State University, Moscow, 119991 Russia e mail: zakharov@dynamo.geol.msu.ru; simon@geol.msu.ru Received March 24, 2009 Abstract--In this work original algorithms are proposed that allow us to provide a set of points (clusters) on a surface that are in cooperative motion, on the basis of an analysis of GPS data. ... Method O1. ...

Еще в разделе: (Показать все результаты (>16) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Koronovsky_etal_2015_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_etal_2013_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_2_eng.pdf

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.ru/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.su/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>24) - rswater.phys.msu.ru/ )

• Group of laser spectroscopy of solutions of supramolecular compounds and