... О практикуме . Баллы . ... 31.08.2012 04:12 / admin . Начала работать новая страничка практикума по базам данных. Здесь можно будет найти методические материалы, текущие баллы и оценки, а также другую полезную информацию. ... Комиссия по практикуму . Зачет по практикуму . ... SQL Server для практикума . Практикум в осеннем семестре . Информация о зачете . ... Декабрь 2014 . Декабрь 2013 . Октябрь 2013 . ... Декабрь 2012 . ... Copyright 2012-2013 - spprac.cs.msu.ru . ...

Еще в разделе: (Показать все результаты (>2) - spprac.cs.msu.ru/ )

• Методические материалы | Практикум по Базам Данных

Department of Physics, Lomonosov Moscow State University . ... We need both good experimentalists and theorists, that want to work, to acheive this difficult goal. ... Molecular transistor based on a Scanning Tunnel Microscope tip (Laboratory of Cryoelectronics 1996) . ... Division of Atomic Physics, Plasma Physics, and Microelectronics . E: This email address is being protected from spambots. You need JavaScript enabled to view it. ... Faculty of Physics . ...

Еще в разделе: (Показать все результаты (>6) - cryolab.phys.msu.ru/ )

• Nikolay V. Porokhov
• Alexander G. Maresov

... CM4all Offers Web Hosts WebDrive . ... emulates the Windows Explorer through a browser based interface. basically the approach of having your windows explorer in the Web browser, he says, having all your files in some professional managed data center and professional storage system, which gives you ... of an existing CM4all installation or independently for companies already using other tools or ISPs not interested in offering Web hosting ... michael kors outlet uk . ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>34) - elana.sinp.msu.ru/ )

• north face outlet uk as well as increasing interest from companies throughout
• michael kors outlet uk APTN wants staff to redesign news | С Днем Победы!

In situ 3/04/2012 1 d =- i ( i d i ) d = + d ln s () ~ 1015 /2 ~ 10-9 /2 2 - . ... a = -2g 3 Furier-transformed infrared spectroscopy (FTIRS) ґ - - In situ - : - second harmonic generation (SHG) ґ ; - surface enhanced Raman scattering (SERS) ґ () Electromodulation infrared spectroscopy (EMIRS) ґ Subtraction normalized infrared spectroscopy (SNIFTIRS) ґ c Surface enhanced infrared absorption spectroscopy ( SEIRAS ) ґ 200 ґ 4000 -1 350 ґ 800 4 ...

Еще в разделе: (Показать все результаты (>31) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf

Accumulation of deleterious mutations and fitness in a pre-industrial human population Adam D. Hayward, Virpi Lummaa, Georgii A. Bazykin Many of the mutations are detrimental to fitness, and each individual carries a burden of deleterious mutations that were accumulated over many generations. ... Individuals whose fathers, grandfathers and great-grandfathers fathered their lineage at age of 20 were 9% more likely to survive to adulthood than those with 40-year-old male ancestors. ...

Еще в разделе: (Показать все результаты (>118) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/35.pdf
• OMICS Startup Contest
• MCCMB'15 - OpenConf Peer Review & Conference Management System

Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>7) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102

... Home . ... Linguistic expeditions . ... People . ... Photogallery: Kislokan , Evenkia, July-August 2008 . Kislokan . Kislokan at sun - set . Kislokan after the rain . A Foggy morning in Kislokan . ... Kislokan helicopter landing site. ... People of Kislokan . ... The first medical help (Nadezhda Leonidovna Gayanchuk and Anatoliy Petrovich Mongo) . People of Kislokan with their dogs . ... Anatoliy Petrovich Mongo . ... Students participated in the expedition . ...

Еще в разделе: (Показать все результаты (>6) - lcl.srcc.msu.ru/ )

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

Еще в разделе: (Показать все результаты (>2) - smu.cmc.msu.ru/ )

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

CUDA Center of Excellence NVIDIA 22 ? ? ґ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - ? ? : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>3) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

114. Замечание Михаила Городецкого

115. http://danp.sinp.msu.ru/Articles_GSIB/nimb206_902_Yamada_largeClasterIonCurrent.pdf

116. http://ics.org.ru/upload/iblock/970/119-some-comments-to-the-paper-by-a-m-perelomov-quot-a-note-on-geodesics-on-ellipsoid-quot-rcd-2000-5-1-_ru.pdf

117. Program topics

118. http://plantphys.bio.msu.ru/conferences/thesis/2014_plantphys.pdf

119. http://aislepkov.phys.msu.ru/?p=1

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда