... Полная версия этой страницы: конференция Касперского . Студенческий форум Физфака МГУ > Общий > Работа . ... Лого лаборатории Касперского . ... Внеси свой вклад в будущее информационной безопасности и выиграй поездку в Германию (г. Мюнхен) на международный тур студенческой конференции . ... Участников конференции ждут увлекательные мастер-классы с экспертами 'Лаборатории Касперского', экскурсия по 'Лаборатории', карьерные возможности и перспективы профессионального роста, призы и подарки. ...

Еще в разделе: (Показать все результаты (>302) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Вечные двигатели
• Студенческий форум Физфака МГУ > ZFC IS INCONSISTENT.

... Russia and France have contributed significantly to scientific and research progress and cultural development of mankind. ... This is the reason for the international academic community to be closely monitoring today the reform, which is taking place in the educational systems of Russia and France, believing that the outcome of these changes will create new opportunities to strengthen the intellectual capacity and adapt to new economic and technological trends for a large number of countries. ...

Еще в разделе: (Показать все результаты (>33) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/2011_09_02/1.pdf
• http://www.rsr-online.ru/doc/norm/544.pdf
• http://www.rsr-online.ru/doc/norm/242.doc

... Intelligent systems . ... Keywords : visual recognition, discrete-geometrical approach, image coding. ... Keywords : genetic programming, symbolic computations, intelligent systems . ... This article describes such system. ... Keywords : ant algorithms, artificial immune systems . Kotelnikov S.V. Intelligent system training skills of REFAL langauge programming . ... Keywords : interpreter, intelligent system, Java EE . ... Keywords : Intelligent Information System, bilingual, dictionary . ...

Еще в разделе: (Показать все результаты (>59) - www.intsys.msu.ru/ )

• Intelligent Systems :: Magazine :: Web archive :: Volume 13, issue 1-4, 2009
• Intelligent Systems :: Magazine :: Web archive :: Volume 15, issue 1-4, 2011
• Intelligent Systems :: Research :: :: Articles

ISSN 0145 8752, Moscow University Geology Bulletin, 2013, Vol. ... On the Mechanism of the Generation of Seismic "Nails" V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru Received March 11, 2013 Abstract--The spatial and temporal peculiarities of seismic "nails" are analyzed. Some nails are related to strong earthquakes, or volcanic eruptions, while some do not show any coincidence with any fault zone or other tectonic structures. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2011_1_eng.pdf
• Summaries of articles
• Publications of V.Zakharov

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... In this case the simultaneity of the occurrence of the change-points generated by different systems gives an evidence of some kind of connectivity in their functioning. Detailed information about signal generation, as well as constructing the model of the signal, is not required, only some concept of the functionally significant components composing the signal is helpful. ...

Еще в разделе: (Показать все результаты (>48) - brain.bio.msu.ru/ )

THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...

Еще в разделе: (Показать все результаты (>9) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf
• Laser-Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ
• Thomson Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>5) - discours.philol.msu.ru/ )

• Summer School Archives

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>7) - psyberlink.flogiston.ru/ )

... Is it correct ? ... V-gauge ansatz LS-equation V-SFA (first Born, Bauer) V-gauge ansatz The corresponding L-gauge ansatz gives the same V-SFA. Formula (10) generates the gauge-invariant family. L-gauge ansatz LS-equation L-SFA (first Born, Keldysh) L-gauge ansatz The ansatz (11) generates now another gaugeinvariant family. ... Conclusions Correct gauge transformation of the chosen ansatz gives the gauge invariant Born series, which can be called as the gauge invariant family. ...

Еще в разделе: (Показать все результаты (>8) - lmmqsp.sinp.msu.ru/ )

... Berezhnoy A.A., Kozlova E.A., Shevchenko V.V. Sternberg State Astronomical Institute, Moscow University, Russia, Moscow, Universitetski pr., 13, 199992. katk@sai.msu.ru According to the data from "Lunar Prospector" [1] the areas of high hydrogen content in the lunar south pole region coincide with the areas of such craters as Faustini (87.2є S, 75.8є E), Cabeus (85.2є S, 323є E) and other crates. ... We estimate the total permanently shadowed area in the lunar northern polar region at 28 260,2 km2. ...

Еще в разделе: (Показать все результаты (>72) - selena.sai.msu.ru/ )

• Бережной А.А.
• Aleksei A. Berezhnoi

... Special attention is paid to linear Hamiltonian systems. The paper discusses the general problem of integrability of the systems of autonomous differential equations in an n-dimensional space, which admit the algebra of symmetry fields of dimension n. Using a metho d due to Liouville, this problem is reduced to investigating the integrability conditions for Hamiltonian systems with Hamiltonians linear in the momenta in phase space of dimension that is twice as large. ... Theorem 1. ...

Еще в разделе: (Показать все результаты (>135) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...

Еще в разделе: (Показать все результаты (>49) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/photos/achievements/asa_2013.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/inclined.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/cone_asymptotics.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

In situ 3/04/2012 1 d =- i ( i d i ) d = + d ln s () ~ 1015 /2 ~ 10-9 /2 2 - . ... a = -2g 3 Furier-transformed infrared spectroscopy (FTIRS) ­ - - In situ - : - second harmonic generation (SHG) ­ ; - surface enhanced Raman scattering (SERS) ­ () Electromodulation infrared spectroscopy (EMIRS) ­ Subtraction normalized infrared spectroscopy (SNIFTIRS) ­ c Surface enhanced infrared absorption spectroscopy ( SEIRAS ) ­ 200 ­ 4000 -1 350 ­ 800 4 ...

Еще в разделе: (Показать все результаты (>56) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf
• Laboratory of Electrocatalysis and corrosion
• Laboratory of Electrical Double Layer and Electrode Kinetics

Summary Period: Last 12 Months . Generated 01-Nov-2004 06:46 MSK . ... Monthly Totals . ... Files . ... Oct 2004 . ... Sep 2004 . ... Aug 2004 . ... Jul 2004 . ... Jun 2004 . ... May 2004 . ... Apr 2004 . ... Mar 2004 . ... Feb 2004 . ... Jan 2004 . ... Dec 2003 . ... Nov 2003 . ... Totals . ... Generated by Webalizer Version 1.30 ...

Еще в разделе: (Показать все результаты (>122) - www.fadr.msu.ru/ )

• Abstracts
• Contens
• Proposition

Title Author Key words Inequality and discrimination of immigrants belonging to non-European cultures and their descendants in Russia and Western Europe Sinelnikov A.B. multiculturalism, assimilation, integration, generations, intermarriages, religion discrimination, immigrants, Abstract An article is devoted to relations between non-european (predominantly Moslem) immigrants and main population of Russia and Western Europe. ...

Еще в разделе: (Показать все результаты (>63) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/10.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/24.pdf
• http://www.socio.msu.ru/documents/umo/bologne/Magna%20Charta%20Universitatum.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

Sign in Register . ... Resources . ... info@ecfs.msu.ru . All contacts . ... Home Resources Projects CIMMYT Informa 1855 . 06 October 2015 . Climate change figures prominently in todayтАЩs Informa, with reports on how the phenomenon will affect maize farming in southern Africa and on efforts to generate heat resilient maize for Asia. Researchers in Africa also attended training on how to breed for insect resistance in maize. ... To leave a comment you must log in or register . ...

Еще в разделе: (Показать все результаты (>14) - ecfs.msu.ru/ )

• Online Consultation on Network and Partnerships in the area of Food Security |
• Resources | ECFS

Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>4) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102