ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
... This assumption is grounded in the classical theory of stationary turbulence in the limit of infinite Reynolds number (e.g. Corrsin, 1951). ... The ratio of diffusivities is obtained as a function of buoyancy Reynolds number Reb and of the density ratio R (the ratio of the contributions of heat and salt to the density stratification). ... The main results are in section 5, where potential energy components, scalar variances and turbulent diffusivities for the two scalars are examined. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf -- 2298.1 Кб -- 11.11.2009 Похожие документы
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Scientific goals . Cosmic rays of extremely high energy . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... An attempt to register cosmic rays of extremely high energy of ~10 19 -10 20 eV, i.e. in the region of GZK-cut-off, . Today in high energy region we have only limited and contradictory information about the energy spectrum and chemical composition of the particles. ...
Uneex . SeminarTraffic . ... Анализ трафика -- зачем это нужно. ... Источники информации о трафике. ... Cisco accounting и NetFlow ( вот тут информации недостаточно, если кто-то может рассказать про эту часть -- хорошо ). ... В формате SXI (ooImpress) . ... Обзор биллинговых систем и систем учета трафика: http://www.opennet.ru/prog/sml/47.shtml . ... Интересная разработка: система адаптивного агрегирования информации о трафике. http://camelot.iki.rssi.ru/RFFI-02-07-90390 . ... Action: . ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... Chemically Decoupled Nuclei in Five Lenticular Galaxies from SAURON Data O. K. Sil'chenko* Sternberg Astronomical Institute, Universitetski i pr. ... We have now analyzed and published the SAURON data for five galaxies, including the above NGC 3384 and NGC 3623, in which the chemically decoupled nuclei are rather extended (several hundred parsecs) circumnuclear stellar disks. ... 1996 SAURON, Oct. ... In NGC 7280, we found an inner polar ring previously using MPFS data (Afanasiev and Sil'chenko 2000...
ISSN 1560-3547, Regular and Chaotic Dynamics, 2007, Vol. ... RESEARCH ARTICLES Interaction between Kirchhoff Vortices and Point Vortices in an Ideal Fluid A. V. Borisov* and I. S. Mamaev ** Institute of Computer Science, Udmurt State University, Universitetskaya ul. 1, 426034 Izhevsk, Russia Received March 1, 2005; accepted January 14, 2006 Abstract--We consider the interaction of two vortex patches (elliptic Kirchhoff vortices) which move in an unbounded volume of an ideal incompressible fluid. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/099/147-interaction-between-kirchhoff-vortices-and-point-vortices-in-an-ideal-fluid_ru.pdf -- 359.3 Кб -- 28.10.2015 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... World Politics . ... Associate professor, Deputy Dean for scientific research, Faculty of World Politics, Candidate of historical science . ... Associate Professor, the Department of Regional Problems of World Politics, Candidate of historical science . ... Naumkin Vitaly V. - Corresponding Member of the Russian Academy of Sciences, Professor, Head of the Department Regional Issues of World Politics, Doctor of historical science . ...
... By Adele Goldberg and David Robson, copyright 1983, Addison-Wesley, ISBN 0-201-11371-6 . ... Compiled Methods . The Bytecodes . The Interpreter . ... Primitive Methods . The Object Memory . ... 27: Specification of the Virtual Machine . Form of the Specification . ... Objects Used by the Interpreter . ... 28: Formal Specification of the Interpreter . ... 29: Formal Specification of the Primitive Methods . ... An Allocation Algorithm . ... A Simple Reference-counting Collector . ...
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы