Home Search Collections Journals About Contact us My IOPscience The role of scattering on atomic nucleus and of electron state entanglement in single ionization of He by ion impact This article has been downloaded from IOPscience. ... In inelastic scattering, due to the orthogonality of one-electron states, the transitions of different electrons are summed in the amplitude with all other electrons non-active. ... Chem. 45 125. where fppf is the ordinary amplitude of elastic scattering. ...

Еще в разделе: (Показать все результаты (>112) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf
• http://danp.sinp.msu.ru/pci2012/vecher29_stend.pdf
• http://danp.sinp.msu.ru/pci2012/vecher29_2.pdf

... Вы находитесь на сайте кафедры теоретической физики физического факультета МГУ им. М.В. Ломоносова. Здесь Вы можете получить разнообразную информацию о сотрудниках, читаемых курсах лекций, познакомиться с историей кафедры. О кафедре . ... Кафедра теоретической физики физического факультета МГУ им. М.В. Ломоносова, 2006 ...

Еще в разделе: (Показать все результаты (>8) - theorphys.phys.msu.ru/ )

• Сарданашвили Геннадий Александрович

Alexandra A. Zobova . NAME: Alexandra A. Zobova . ... AFFILIATION: Associate Position, Department of Theoretical Mechanics and Mechatronics, . Faculty of Mechanics and Mathematics, . Lomonosov Moscow State University . ADDRESS: Alexandra A. Zobova , . ... Moscow State University, 2008 . ... Laboratory Training for the students of the Theoretical Mechanics and Applied Mechanics and Control Departments . Lecture Course on 'Dynamics of the Systems of Solid Bodies with Friction' . ...

Еще в разделе: (Показать все результаты (>3) - www.theormech.math.msu.su/ )

• Кафедра теоретической механики и мехатроники механико-математического
• Moscow State Lomonosov University

. МГУ . Физический факультет . НИИЯФ . Разделы: . Новости . Лента новостей . Семинары . История . основания . Кафедра . НИИЯФ . МГУ . Научные направления . Астрофизика космических лучей . Космическая . физика . Физика высоких энергий . Студентам . Спецкурсы . Расписание . Курсовые работы . Спецпрактикум . Сотрудники . Научные связи . Выпускники . Разное . Контактная информация . Форум .

Еще в разделе: (Показать все результаты (>6708) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>481) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.Graphicon.Nasonov_Krylov.Metrics.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Lebedev_Ignatenko.Light.en.pdf
• View publication | Laboratory of Mathematical Methods of Image Processing

... 960), Faculty of Philology, 1st Building of Humanities, Lomonosov Moscow State University, Vorob'jovy Gory, Moskva, 119899, Russia . ... Department of Russian Linguistics, . ... Getting of Ph.D. degree for a dissertation "Factors and Regularities of Analyticity Development in Language" (Moscow State University, Department of Structural and Computational Linguistics) . ... A member of Moscow University Academic Council for defending doctoral degrees in Slavic and Russian Linguistics (2001 - till now)...

Еще в разделе: (Показать все результаты (>63) - old.philol.msu.ru/ )

• Khmelev D.V.- Disputed Authorship Resolution Using Relative Empirical Entropy
• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of

Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. ? alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...

Еще в разделе: (Показать все результаты (>951) - magn.phys.msu.ru/ )

• Some materials
• Official site of magnetism division of MSU

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

Еще в разделе: (Показать все результаты (>3) - www.fnm.msu.ru/ )

announces . seminars & conferences . Zelmanov' seminar . scientific & engineering staff . students & postgraduates . useful links . projects . articles . catalogs & databases . algorithms & programming . 1 mas (отчет о первой астрометрической школе) . Труды ГАИШ . history of Moscow astronomical observatory . photo gallery . miscellaneous . Some pages are now in Russian only. editor valera , . librarian gribko .

Еще в разделе: (Показать все результаты (>27) - astrometric.sai.msu.ru/ )

• Literature
• Geography

... It is far easier: to apply for that type of visa one needs a voucher that can be issued by any travel/tourist agency in your home country (but better select an agency recommended by the appropriate Russian Consulate; please note that a hotel reservation even supported by a letter of invitation from the conference organizers is not sufficient to apply for a tourist visa, it is a voucher that is requested). ... 6) After getting the form, one can apply for the Russian visa. ...

Еще в разделе: (Показать все результаты (>28) - www.spa.msu.ru/ )

• Visa support application form

Pb-Pb ALICE 19 2013 1 Introduction 1.Ultrarelativistic heavy-ion collisions (HIC) 2. Directed and elliptic flow 3.The purposes of the thesis research 4.Tools for the research: Collider Experiment: the ALICE detector Monte Carlo simulation of HIC: HYDJET++ ЇPhenomenological investigation of anisotropic flow in HYDJET++ model ЇSummary Ї Directed flow measurement in experimental ... Flow components: Directed flow at forward rapidity 62 34 Model parameters. ALICE week October 2008 1. ...

Еще в разделе: (Показать все результаты (>60) - lav01.sinp.msu.ru/ )

• Sergey Petrushanko PHOTOS from the different events
• Etapi- Comments 3/1/97

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>4) - ndsipu.cmc.msu.ru/ )

... 2009 тАФ Ph.D. in General History (Institute of General History, Russian Academy of Science, Moscow) . ... The mid-French Literary Text: Transition from Manuscript to Incunabula Form and its XV-century Readers. 1995 тАФ MS in the History of Medieval France (Moscow State University, History Department ) . ... Training course in anthropology and cultural studies . ... Central State Museum of the Cinema, Moscow (2009 тАФ to date) . ... State University for Human Sciences, Moscow (2008 тАФ to date) . ...

Еще в разделе: (Показать все результаты (>15) - discours.philol.msu.ru/ )

• Tatiana Venediktova
• Contact us
• Department

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• The Department of land resources | ECFS
• Communication and Information Department | ECFS
• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской

Выпускница кафедры Ольга Павлова, . ... зачислить на кафедру следующих студентов второго курса: . ... Продолжается очередной процесс распределения студентов 3-го курса по кафедрам. ... физического факультета . ... к ответственному на кафедре за работу со студентами 2-го курса . ... с научными направлениями исследований на кафедре Медицинской физики . ... Начался очередной процесс распределения студентов 3-го курса по кафедрам. ... Открылся интернет-сайт Кафедры Медицинской Физики . ...

138. http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf

139. http://dynamo.geol.msu.ru/Crimea/win_right~eng.html

140. Submissions