... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

· Copyright © 2009 MS T'09® New Roles for Electric and Magnetic Fields Einstein's Hidden Variables: Part A - The Elementary Quantum of Light and Quantum Chemistry J. Brooks General Resonance LLC, Havre de Grace, MD, USA Keywords: Planck , Hidden variable, Light , Time , Photon Abstract Re-examination of the work of Max Karl Planck has revealed hidden variables in his famous quantum ... Planck's quantum formula ("E = h") is missing the variable for measurement time. ... M. Planck. ...

Еще в разделе: (Показать все результаты (>494) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/correlations.12yr.pdf
• http://temporology.bio.msu.ru/EREPORTS/endophysics.pdf
• http://temporology.bio.msu.ru/RREPORTS/berkovich_prime_energy.pdf

Downloaded 03 Aug 2005 to 131.215.252.196. Redistribution subject to AIP license or copyright, see http://rsi.aip.org/rsi/copyright.jsp Downloaded 03 Aug 2005 to 131.215.252.196. ... Redistribution subject to AIP license or copyright, see http://rsi.aip.org/rsi/copyright.jsp ...

Еще в разделе: (Показать все результаты (>105) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/dating/vesuvius_u.pdf
• http://hbar.phys.msu.ru/gorm/fomenko/fomenko5.pdf
• http://hbar.phys.msu.ru/gorm/fomenko/fomenko10.pdf

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации

... In this case both the medium and the electric field depend on two space coordinates only. ... The classical modeling presentation is in apparent resistivity which reflects an electric field distribution on the earth's surface. ... An expression can be derived for the potential value in point M ([pic]): [pic], (4) where [pic] is the potential of the primary electric field, [pic] is the potential of the secondary electric field, defined by the surface charge distribution. ... pic] |[pic] | ...

Еще в разделе: (Показать все результаты (>47) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Theory of resistivity sounding

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>16) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/Brockett.pdf

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>18) - www.cie.ru/ )

... Программа на сентябрь 2008 г. 24 сентября. H. Wakaki (Hiroshima University). An error bound for Box's chi-square type asymptotic expansion of Wilks' Lambda distribution. Abstract. An error bound for the Box's chi-square type asymptotic expansion of Wilks' Lambda distribution is derived. It is compared with an error bound for the high-dimensional Edgeworth expansion. ... Convergence of Multinomial Goodness-of-fit Statistics to Chi-square Distribution. ...

Еще в разделе: (Показать все результаты (>46) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk11_13.htm
• http://new.math.msu.su/department/probab/bsk10_14.htm
• Vestnik Moskovskogo Universiteta. Matematika, Mekhanika

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>66) - scon155.phys.msu.su/ )

• Effect of Coulomb Interactions on the Density of States in Intentionally
• Theory of electronic properties of disordered semiconductors and systems with
• Igor P. Zvyagin

Higher-order anisotropic flows and dihadron correlations in Pb-Pb in AMPT" Jun Xu and Che Ming Ko Phys.Rev. C84 (2011) 044907, arXiv 1108.0717 .. ... Description of High harmonics and Ridge effect in AMPT. 2Part and Flow correlation 4. <uQ*> Some useful formulae, I Some useful formulae, II Some useful formulae, III Some useful formulae, IV Results, A. Anisotropic flows, centrality AMPT 1. ... B. Dihadron correlations, ||and pT Jet region Ridge region trigg 1. ... B. Dihadron correlations, || ...

Еще в разделе: (Показать все результаты (>51) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/Porteboeuf-Houssais_AFTER_Mai2012_AMPT.pdf
• http://lav01.sinp.msu.ru/~vlk/Universality_PVn_PEccn.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf

... Языки . ... Т-языки . ... URL: . http://glade.nmd.msu.ru/magnate/tc2c . Status: . ... Todo: . ... Зафиксировать версию языка TC, которая будет поддерживаться в прототипе промышленной версии Т-системы . People: . ... Реализовать front-end (сканер и парсер) для подмножества одного из широко распространенных скриптовых языков программирования (таких, как, например, TCL) . ... http://glade.nmd.msu.ru/~pooh/refal-plus http://glade.nmd.msu.ru/~pooh/rfrt/rfrt.html . ...

Еще в разделе: (Показать все результаты (>3) - cluster.msu.ru/ )

Unitherm for Windows (version 4.5) Contents Unitherm for Windows compared to Unitherm for DOS 2 General comments 2 Limitations of Unitherm for Windows compared to Unitherm for DOS 2 Changes in Unitherm interface 2 New functionality of Unitherm for Windows 2 Specific features of Unitherm for Windows 3 Localization 3 Graphical user interface of Unitherm for Windows 4 The main ... mode. ... The window is opened with the List of reactions command of the Unitherm Reaction menu. ...

Еще в разделе: (Показать все результаты (>55) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Faculty of Geology >> Our adjunct Professors

... Acting Head of the Laboratory: Gamayunov Dennis, Senior Research Fellow, PhD. Contact information . ... The Laboratory of Information Systems Security was founded in 2011 at Computational Mathematics and Cybernetics Faculty of Lomonosov Moscow State University (CMC MSU) on the basis of Information Systems in Education and Research Laboratory. Primary activities of the Laboratory are: 1) research and development in the area of cybersecurity and information systems security and 2) education. ...

Еще в разделе: (Показать все результаты (>102) - en.cs.msu.ru/ )

• Laboratory of Information Systems Security
• Research Laboratory of Computational Modeling Tools | CMC MSU
• International Scientific Conference "Probability Theory and its Applications"

... Malkhazova S.M. (ecology, medical geography), Doctor of Geography. ... Biology, Ecology with the fundamentals of biogeography , Biogeographic basis for nature conservation, Mathematical methods in biogeography , Methods of field studies, Diversity of organisms, Ecology of human, Biogeographical mapping , GIS in biogeography and ecology , Ecology of organisms, Biogeography of foreign countries, Biogeography of Russia, Bioindication and Biomonitoring, Geography of utilization of ...

Еще в разделе: (Показать все результаты (>33) - eng.geogr.msu.ru/ )

... 7.1] Lectures of prof. Scrucca in Advanced quantum field theory (e.g., for the first study of the worldline formalism): http://itp.epfl.ch/webdav/site/itp/users/181759/public/aqft.pdf . ... I. Topological quantum effects Lecture 1 (Spring 2015) , The Outline Before Casimir: the van der Waals forces (presentation, pdf) . ... Lecture 5 (Fall 2015) , Lattice field theory: 'free fields' (presentation, pdf) . Lectures 6-7 (Fall 2015) , Lattice field theory: 'interacting fields'. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

• Сарданашвили Геннадий Александрович

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>8) - acm.msu.ru/ )

... До 1 ноября Springer предоставляет бесплатный доступ к более чем 150 математическим журналам . From today to November 1, 2006: Enjoy free access to all journal issues back to 1869. Get exclusive, unlimited access to more than 150 journals, including: . ... Mathematische Annalen . Mathematische Zeitschrift . ... Read and download any article from the complete archive of all journals including classics like Acta Mathematica and Mathematische Annalen dating back to the 19th century. ...

Еще в разделе: (Показать все результаты (>179) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация
• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida
• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия

... Магистерское образование . ... Магистерские программы . ... Магистерские программы (учебные планы) . ... Introduction to Cryptography . ... Basic requirements for data security in software systems. ... Lecturer: associate professor Primenko E. A. Mathematical Theory of Information . ... Addition operation of elliptic curve's points. f Postnikov's theorem.Theorems on the order of elliptic curve for certain types of primes. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

• Master Education | Магистерское и послевузовское образование Entrance
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и