... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Many hydrolytic proteins have quaternary structure and consist of even protomers number. ... Catalytic activity was determined by spectrophotometric method with the use of rhodamine 6G, amount of protein was assayed by Lawry method. ... Lipase surface character was observed by acid-base titration method. ... This method allows to obtain an image of immobilized on mica lipase surface, and this permits to conclude an important role of quaternary structure in lipase catalytic activity regulation. ...

Еще в разделе: (Показать все результаты (>76) - www.msm.biophys.msu.ru/ )

• MSM 2007

... 0 The function w1 is the edge Green's function for the Neumann problem. ... The explicit form of the co ordinate equations The explicit expressions for 1 X1 2 X1 X= 3 X1 4 X1 where 1 X1 = cos cos sin 1 X2 1 1 cos - 2(C1 + E1 ) sin , 2(1 - cos2 sin2 ) 1 E 1 cos - C2 sin = - cos cos sin 2 , 1 - cos2 sin2 the coefficients of the coordinate equations 1 1 1 1 X2 X3 X4 Y1 Y21 Y31 2 2 2 Y2 Y2 Y2 X2 X3 X4 , Y = 13 23 33 3 3 3 Y1 Y2 Y3 X2 ...

Еще в разделе: (Показать все результаты (>47) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/inclined.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/ursi1.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf

... Author to whom correspondence should be addressed; E-mail: babaev@org.chem.msu.su Received: 23 April 2005 / Published: 30 September 2005 Abstract: Various 2-substituted indolizines can be directly and selectively lithiated in the 5 position and subsequent reactions with different electrophiles lead to some novel classes of indolizines. ... Keywords: Direct lithiation, 5-lithiumindolizine, 5-formylindolizine, 5-iodoindolizine, 5-benzoylindolizine, Suzuki reaction, reduction, oxime. ... Table 1. ...

Еще в разделе: (Показать все результаты (>144) - www.chem.msu.ru/ )

• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW
• Intuitive Chemical Topology Concepts

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>6) - www.students.chemport.ru/ )

. Пользователям: . Авторизация . Регистрация . Аксиома это истина, на которую не хватило доказательств. Форумы > Разное > Профайл пользователя . Форумы Список тем . observer [ Найти все посты ] . ICQ: . 235649320 . Посты: . 5 . Дата регистрации: . 06.02.2006 22:45 . Последний визит: . 29.08.2006 12:11 . Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . Правовая информация Свяжитесь с нами Участие в проекте Разместить рекламу .

Еще в разделе: (Показать все результаты (>170) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>23) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• Using spherical functions (from A.Granovsky manual) ERG Research Group:

... Biotechnology in Russia [Biotech Rus] . Common information . ... no information] . ... since 1984-01-01 till today . ... biology ->biotechnology . ... 144) . ... http://www.genetika.ru/journal/index.jsp . ... 1985 . ... today . ... http://www.genetika.ru/journal/years.jsp . ... http://elibrary.ru/issues.asp?id=2451 . ...

Еще в разделе: (Показать все результаты (>1290) - journals.genebee.msu.ru/ )

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

... Course ?Microcontroller Programming? is presented in two formats: . 32-bit microcontrollers . ... Acquired skills: practical skill of microcontroller programming on C; working with standard peripherals such as UART, digital display, ADC, pulse-width modulator, timer, etc. ... The duration of each special course within the frames of this program is two semesters. Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ...

Еще в разделе: (Показать все результаты (>97) - engineering.phys.msu.ru/ )

• Introduction to Linux

... Usually runs in the end of a calibration period are acceptable · GroupID format is YYGG.S ­ a float, YY ­ year {8,10}, GGgroup {1,99}, S ­ subgroup {1,} (possibly YYGG.S.S) Example of a group Group 1001.1.1 - 3N+ 2T3 (+GC) Fit and distance 2010 III I II Line reconnections I. 14/11/2009 ­ 11/09/2010, 10 lines 3N+ 2T3 , 1001.1, 187316 min (130 days ) 1/2 gain , 1001.2, 14231 min (10 days ) 1/4 gain , 1001.3, 34230 min (24 days ) 1/8 ... For preliminary and problematic runs. ...

Еще в разделе: (Показать все результаты (>15) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Invited speakers

... In semiconductors, inversion symmetry is also broken by the dc electric field DCF in the subsurface space-charge region SCR , which is created by initial band bending and/or external bias application. ... These differences in bias dependences of static and modulated EFISH intensities can be explained by the influence of traps interface states , located at or near the Si- SiO2 interface, with a charge dependent on the interface potential. ... 4 N. Bloembergen and Y. R. Shen, Phys. Rev. 141, 298 1966 ...

Еще в разделе: (Показать все результаты (>29) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/02_JOSAB_19.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/04_JETP98_THG.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/97_josa_14.pdf

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Keldysh Institute of Applied Mathematics of RAS . DRIVER: 3D numerical modelling of high energy density plasma physics . ... AREA: Plasma Physics . ... IMPACT: The expected results of numerical experiments will help to explain the observed statistical characteristics of molecular hydrogen clouds in external galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>35) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• APPLICATIONS: Astronomy | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... These CDD-NDs are produced by specific acid treatment of detonation soot, forming tiny rounded sp2 carbon species (carbon dots), 1­2 atomic layers thick and 1­2 nm in size, covalently attached to the surface of the detonation diamond nanoparticles. ... In this paper, we report that specific acid treatment of NDcontaining detonation soot, produces tiny rounded sp2 carbon species (carbon dots), which are 1­2 atomic layers thick and covalently attached to the surface of DND particles. ... Figure 4. ...

Еще в разделе: (Показать все результаты (>23) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>34) - nanofluidics.phys.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

... Absorption lines of neutral and singly ionized metals, blueshifted 50 km s-1 relative to the star, were found. ... The gas temperature of the wind is definitely below 10 000 K, but metals (and probably sulfur) are almost completely singly ionized by strong stellar emission in the hydrogen lines of the Lyman series. ... Conclusions The UV emission spectrum of RW Aur A is strongly disturbed by absorption lines of singly ionised metals originating in the stellar wind. ...

Еще в разделе: (Показать все результаты (>77) - sai.msu.ru/ )

• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/iii/vartype.txt
• http://www.sai.msu.ru/gcvs/gcvs/iii/vartype.txt
• General Catalogue of Variable Stars: Variability Types

PHYSICAL REVIEW A VOLUME 58, NUMBER 5 NOVEMBER 1998 Modification of resonance fluorescence and absorption in a B. A. Grishanin and V. N. Zadkov system by four-wave mixing International Laser Center, M. V. Lomonosov Moscow State University, Moscow 119899, Russia D. Meschede Ё Ё Institut fur Angewandte Physik der Universitat Bonn, Wegelerstrasse 8, D-53115 Bonn, Germany Received 4 June 1998 A universal mechanism destroying coherence in a system driven by two resonant ...

Еще в разделе: (Показать все результаты (>74) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/JETP-1999-89(4)-en.pdf
• http://qilab.phys.msu.ru/papers/VMU-No.%205,%20pp.%20315-320%20(2008)-EN.pdf
• http://qilab.phys.msu.ru/papers/SPIE-3736-246-244(1999).pdf