... Data . Издательство: American Chemical Society . ... 2012 IUPAC-NIST Solubility Data Series. ... в журнале Journal of Physical and Chemical Reference Data , издательство American Chemical Society (United States) , том 41, ? ... Gamsja?ger H. , Magalha?es M.C. , Konigsberger E. , Sawada I.K. , Churagulov B.R. , Schmidt P. , Zeng D. в журнале Journal of Physical and Chemical Reference Data , издательство American Chemical Society (United States) , том 40, ? ...

Еще в разделе: (Показать все результаты (>4361) - istina.msu.ru/ )

• Mauri Andrea - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Soins; la revue de reference infirmiere - журнал | ИСТИНА - Интеллектуальная
• Dolgachev V.P. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>20) - www.moip.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Function Name Cross Reference . Up: C++ Bindings on all MPI Classes Next: Index Previous: Inter-language Operability . Since some of the C++ bindings have slightly different names than their C and Fortran counterparts, this section maps each language neutral MPI-1 name to its corresponding C++ binding. ... Where MPI-1 names have been deprecated, the < none > keyword is used in the ``Member name'' column to indicate that this function is supported with a new name (see Annex Language Binding ). ...

Еще в разделе: (Показать все результаты (>420) - www.parallel.ru/ )

• Opaque objects | PARALLEL.RU - Информационно-аналитический центр по
• MPI's Support for Libraries | PARALLEL.RU - Информационно-аналитический центр
• Problems compiling or linking Fortran programs | PARALLEL.RU -

J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>4) - lab110.imec.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>4) - vernov-relec.sinp.msu.ru/ )

Research topics . ... This group is formed to study the reactions at semiconductor surfaces. ... Group members: . ... M.V. Lomonosov Moscow State University: . ... Dr. Tatiana S. Zyubina, senior scientific researcher (quantum chemical modeling) . ... Joint Semiconductors Surface Study group: research sketches . The Joint Semiconductors Surface Study (JSSS) group was developed on the base of Inorganic Chemistry division, Chemistry dept. of M.V. Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>49) - www.inorg.chem.msu.ru/ )

• Diploma
• Current Research Projects Grants

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>11) - top.sinp.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... We plan to create a multi-channel analyzer through a detector which comprises a semiconductor in addition to the selective line of resistive type sensors , the sampling system also allowing to carry out a catalytic conversion and concentration of target gases. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>38) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials
• The Laboratory of chemistry and physics of sensor and

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>19) - erp.cmc.msu.ru/ )

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )

... M.V.Lomonosov Moscow State University . ... Research Centers . ... Research . ... Education research . ... Research Highlights of the Year . Research Highlights Archive . ... Moscow State University opens competition for scientific projects at the Russian segment of the International Space Station. This program is dedicated to the 250th jubilee of Moscow State. More detailed information about the competition and the project itself can be obtained at the web-site of the project. ...

Еще в разделе: (Показать все результаты (>225) - phys.msu.ru/ )

• Scoolboys competition within the frame of the MSU-sputnik-project
• INTAS объявляет прием заявок 2004 на конкурсы научных проектов
• A glimse back into the history of the Faculty of Physics

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>11) - hsmi.msu.ru/ )

• Project and Process Management | MSU Higher school of management and innovation

Spes_innov_06_2007.qxd 10.07.2007 17:35 Page 1 Vivat academia! , . ... Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л Ё, лЁ 3D . ... лЁ , , Spes_innov_06_2007.qxd 10.07.2007 17:38 Page 3 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 3 Ё. , . ... Spes_innov_06_2007.qxd 10.07.2007 17:41 Page 6 6 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л л Ё 2007 . ...

Еще в разделе: (Показать все результаты (>15) - inpro.msu.ru/ )

... A particularly interesting family of examples are given by the weighted projective spaces CP n (), which depend upon a vector of positive integral weights (0 ,...,n ) for their definition. ... Nevertheless, the ultimate goal is to outline recent work with Tony Bahri and Matthias Franz, in which we compute the equivariant integral cohomology ring HT (CP n ()), with respect to the action of the standard compact n-torus T < (C \ 0)n . ...

Еще в разделе: (Показать все результаты (>33) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Krasovskii.pdf

... Division of General Nuclear Physics MSU . ... INP MSU . ... Faculty of Physics MSU . ... The ANTARES project is the largest project on registration astrophysical neutrino by detection of cherenkov radiation from secondary particles, arising by neutrino interaction with substance of the Earth. ... Since June, 2009 the group of the Lomonosov Moscow State University takes part in the project. ... Our group consists of young researchers of MSU Skobeltsyn Nuclear Physics Institute and Faculty of Physics....

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• ANTARES в МГУ

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>14) - iconolat13.phys.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...