... Почти) полный список публикаций ((Almost) complete list of publications) . ... Список работ под редакцией (List of publications under editing) . ... D. V. Georgievskii, M. V. Shamolin and Prof. of Bauman Moscow Technical University S. A. Agafonov (Scientific Seminar "Actual Problems in Geometry and Mechanics" under research advising of Profs. ... If you have any questions send me e-mail to: shamolin@imec.msu.ru , shamolin@rambler.ru , shamolin.maxim@yandex.ru . Inmech Main Page . ...

Еще в разделе: (Показать все результаты (>62) - shamolin2.imec.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>263) - www.genebee.msu.ru/ )

• Databases
• Genebee Predicted Annotation - Advanced
• Selected Scientific Journals - Search Engines

VIII INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT'2002) 24-28 June, 2002, Moscow, Russia INFORMATION BULLETIN No.2 This bulletin No. 2 contains the following information: - a preliminary list of the Plenary/Invited talks; - a list of tutorials; - updated information on accommodation, proceedings and deadlines; - information on HP grants for participants from Russia and other FSU Republics. ... For details on available hotels, please visit our Web-page. ...

Еще в разделе: (Показать все результаты (>80) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/visa.html
• http://acat02.sinp.msu.ru/form/hotel_form.doc
• http://acat02.sinp.msu.ru/accomod.html

... Announcement of the Availability of the LSI Logic International Services Scholarship to Post-Graduate Students of Moscow State University and Moscow Institute of Physics and Technology . ... Interested applicants should submit the following documents not later than September 26, 2003 : . ... LSI Logic International Services is wholly own subsidiary of LSI Logic Corporation, Milpitas, California. ... LSI is headquartered at 1621 Barber Lane, Milpitas, CA 95035. ... LSI Logic . ...

Еще в разделе: (Показать все результаты (>477) - www.mmonline.ru/ )

• MMOnline | Аспирантура | Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Новости | Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Форумы | Разное | Front Page

... Currently there are 27 faculties - of Mechanics and Mathematics, Computational Mathematics and Cybernetics, Physics, Chemistry, Geology, Biology ... Sociology, Institute of Asian and African Studies, Public Administration and Social Studies, Materials Sciences, Pedagogy, Arts, International Relations, Bioengineering and Bioinformatics, Continuing Education , Center for International Education The total number of students including post-graduates is currently 40,000. ...

Еще в разделе: (Показать все результаты (>188) - www.ied.msu.ru/ )

• International Office of Moscow University - Programs and degrees

Department of Russian Art History . ... Fields of study include the History of Fine Arts (Painting, Sculpture, Graphics) and the History of Decorative Art and Architecture in Russia from the Tenth through the Twentieth Centuries. ... Classical, Romantic and Eclectic Trends in Russian Architecture of the Nineteenth Century; the Search for Style; Comparisons to Architectural Experience of Western Europe . Romantic Tradition in Russian Art of the Nineteenth Century . ...

Еще в разделе: (Показать все результаты (>506) - hist.msu.ru/ )

• Department of Southern and Western Slavic History
• Department of Archaeology
• Moscow State University. Faculty of History. Frequently Asked Questions

3D Simulation of Stress - strain State in Pneumatic Tires. ... Moscow State University, Russia . Section 1.1 . ... Mechanical model for computation of Stress - strain State in pneumatic tires. ... Numerical simulation of axisymmetrical Stress - strain State in tires. ... Axisymmetrical Stress - strain State in tire. ... Numerical simulation of 3D Stress - strain State in tires . ... Solution of contact problem on tire contacting rigid surface in view of friction on contact surface. ...

Еще в разделе: (Показать все результаты (>7) - composite.msu.ru/ )

• Department of the Composites Mechanics

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... This is a modification of the original Camera Calibration Toolbox for Matlab by Jean-Yves Bouguet that adds automatic calibration object detection to the functions of the original toolbox. ... The source code can be downloaded lower in this page. v0.31b Download GML Matlab Camera Calibration Toolbox 0.31 11.05.2005 Re-compiled and added correct OpenCV dlls . ... C++ Camera Calibration Toolbox . ...

Еще в разделе: (Показать все результаты (>334) - graphics.cs.msu.ru/ )

• Courses | Graphics and Media Lab
• GML MatLab Camera Calibration Toolbox | Лаборатория компьютерной графики и
• Image-based 3D reconstruction of "generalized box" with user sketches |

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>172) - sp.cs.msu.ru/ )

• DVM system - in English
• DVM-system. Goals and structure
• Lib-DVM. Interface description

... Dahl's texts and dictionaries in the Web (in Russian) . ... Employees of the Laboratory . ... About Laboratory . ... Anatoly Anatol'evich Polikarpov - a head of the laboratory - professor of Russian Language Department [ click here for personal information ] . ... About the laboratory . ... Development of techniques of gathering and analysis of mistakes of foreigners in Russian speech (a series of works of 1985-1991 under the leadership of A.A.Polikarpov with principal assictance by O.V.Kukushkina);...

Еще в разделе: (Показать все результаты (>117) - old.philol.msu.ru/ )

• МГУ - ЛОКЛЛ:: Закон Менцерата
• Large transportation networks with finite-dimensional state space. Asimptotic
• Basic Assumptions about a Sign's Life Cycle for Mathematical Modelling of

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . Run Time: 0.000535 . Select Type . ... Type . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>50) - osk.msu.ru/ )

• http://osk.msu.ru/forum/forums/faq.8/?_debug=1
• http://osk.msu.ru/forum/help/bb-codes?_debug=1
• http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1

... International Studies . ... Admission for International Students . ... For Students . ... General Russian Courses . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... Beginners I - This course aims to help the student to acquire some knowledge of basic Russian, so that s/he can communicate with Russians, using basic vocabulary and grammar to express him/herself. ...

Еще в разделе: (Показать все результаты (>216) - ffl.msu.ru/ )

• About Us
• Факультет иностранных языков и регионоведения
• Иностранным гражданам

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>51) - pont2008.cmc.msu.ru/ )

• Abstracts International Conference Differential Equations and Topology
• Program Committee International Conference Differential Equations and Topology

... Denisov SV, Bazykin GA, Sutormin R , Favorov AV, Mironov AA, Gelfand MS, Kondrashov AS. ... Genome Biol Evol. ... PubMed Pdf . ... 2013 Nov; 14(1):745. ... Kurmangaliyev YZ, Sutormin RA , Naumenko SA, Bazykin GA, Gelfand MS. Functional implications of splicing polymorphisms in the human genome. ... Sadovskaya NS, Sutormin RA , Gelfand MS. Recognition of transmembrane segments in proteins: review and consistency-based benchmarking of internet servers. ... PubMed Pdf (english) , (russian) . ... Pdf . ...

Еще в разделе: (Показать все результаты (>12) - storage.bioinf.fbb.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>60) - erg.biophys.msu.ru/ )

• Quantum chemistry information page ERG Research Group: Лаборатория
• Constructing discrete Laplacian via sparse matrix ERG Research Group:
• Using Firefly/GAMESS-US efficiently ERG Research Group: Лаборатория

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

Еще в разделе: (Показать все результаты (>7) - www.fnm.msu.ru/ )

• Main page
• Contacts

... Отдел культуры древности . Отдел культуры и науки средневековой Европы . Отдел христианской культуры . Отдел русской культуры . ... Mellon Foundation / University of Chicago Dissertation Year Fellowship. ... Francois Furet Travel Grant (summer travel to France). ... FLAS (Title 6) fellowship for summer study of Turkish. ... DAAD Fellowship for summer study in Germany. ... Humanities and Social Sciences Research Grant Summer 1998. ... Soros Graduate Fellowship (grant #H2B70H), 1 year. ...

Еще в разделе: (Показать все результаты (>31) - imk.msu.ru/ )

Pipin V.V., Sokoloff D.D., Zhang H., Kuzanyan K.M., Helicity conservation in nonlinear mean-field solar dynamo, eprint arXiv:1211.2420, 5 pages, 4 fig., 2012. ... Our results support the recent findings by Hubbard Brandenburg (2012), who suggested that the catastrophic quenching in the mean-field dynamo is alleviated if conservation of the total magnetic helicity is taken into account. We show that the solar dynamo can operate in the wide rage of the magnetic Reynolds number up to $10^{6}$. ...

Еще в разделе: (Показать все результаты (>139) - srcc.msu.ru/ )

• Pipin V.V., Sokoloff D.D., Usoskin I.G.,Waldmeier relations and the solar cycle
• Moss D., Sokoloff D., Resonances for activity waves in spherical mean field
• Sokoloff Dmitry CV

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>95) - www.socio.msu.ru/ )

• Вестник МГУ