Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...
Клуб выпускников МГУ (Московский Государственный Университет) . ... Транспозиции MGE увеличиваются с возрастом, давно предполагалось что могут приводить к аккумулированию повреждений ДНК, приводящему в тч к старению (подробнее можно прочитать тут ). Хуже транспозонов могут быть только ретротранспазоны, особый класс транспозонов, способный, через РНК-посредник, копировать себя, а не перепрыгивать, увеличивая таким образом размер генома. ...
pic] [pic] PARTNERSHIP AGREEMENT between the Russian Rectors' Union and the Russia Machine Builders' Union The Russian Rectors' Union (RRU) and the Russian Machine Builders' Union (RMBU), hereinafter referred to as The Parties Confirming the importance of the further development and strengthening of partnership relations between the scientific-educational ...
About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...
TITLE OF THE ABSTRACT FIRST I. AUTHOR1, SECOND I.J. AUTHOR2 AND THIRD AUTHOR2 1Organization name of the first author first_ author@email.ru 2Organization name of the second and third authors second.author@email.com, third_author@mail.eu Key words: list up to eight words or group of words in order of priority, separated by commas. ... The abstract including figures, tables and reference should not exceed 1 page. The title should be centered in the page, in 11pt, boldface Roman, all capital letters. ...
... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ... In spring semester students have 44 hours to work on their term papers on design and then 4 hours for defending...
... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China
Open Conference Systems . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... January February March April May June July August September October November December 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 . ... By default only papers containing all terms in the query are returned (i.e., AND is implied) . Combine multiple words with OR to find papers containing either term; e.g., education OR research . ...
Название статьи И.О. Фамилия11,a, И.О. Фамилия22,b 1 Название института и полный адрес, например: Московский государственный университет имени М.В.Ломоносова, физический факультет, кафедра общей физики. ... Title in English I.O. Pervyiavtor1,a , I.O. Vtoroiavtor2,b 1 Название института и адрес на английском языке, например: Department of [.. ... Moscow 119991, Russia. 2 Название института и адрес на английском языке, например Sternberg State Institute of Astronomy, Moscow State University. ...
[
Текст
]
Ссылки http://waves.phys.msu.ru/files/docs/2016/Template_UZFF_2016.doc -- 46.5 Кб -- 06.04.2016 Похожие документы
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... The number of randomly coinciding change-points (the noise level) can be easily estimated using the total numbers of change-points in each EEG channel, and thus the estimate of the number of systematically coinciding change-points can be cleared from the randomly coinciding change-points, both "true" and "false". ... This number, however, vary with the number of change-points in each channel. ...
... In this article we considerљcalculationљof discrete Laplacian for 1D arrays usingљpython/numpy/scipy. We introduceљthe sparse matrix technique that is rather efficient for computation of certain types of diffusion PDE. ... 1 комментарий " Constructing discrete Laplacian via sparse matrix " . Reaction-diffusion systems in 2D space with python ERG Research Group: Лаборатория теоретической биофизики написал (Январь 26th, 2016 2:13 пп) . ... Constructing discrete Laplacian via sparse matrix . ...
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
... 24, No. 4, pp. 943962 c 2003 Society for Industrial and Applied Mathematics REDUCTION TO VERSAL DEFORMATIONS OF MATRIX PENCILS AND MATRIX PAIRS WITH APPLICATION TO CONTROL THEORY M. I. GARCґ IA-PLANAS AND A. A. MAILYBAEV Abstract. Matrix pencils under the strict equivalence and matrix pairs under the state feedback equivalence are considered. ... In this paper versal deformations of matrix pencils under the strict equivalence and pairs of matrices under the feedback equivalence are considered. ...
[
Текст
]
Ссылки http://mailybaev.imec.msu.ru/papers/GarciaMailybaev2003.pdf -- 237.3 Кб -- 14.06.2005 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы