. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

Fluorescence , Diffuse Reflectance and NIR Imaging in Cardiovascular Research and Diagnostics Gussakovsky E., Kupriyanov V., Sowa M. Institute for Biodiagnostics, National Research Council Canada 435 Ellice Ave, Winnipeg, Manitoba R3B 1Y6 Canada Tel. 1-204-984-4501; email: Eugene.Gussakovsky@nrc-cnrc.gc.ca Three selected topics of VIS-NIR spectroscopy ­ intrinsic fluorescence , diffuse ... An Alentsev-Fok approach-assisted decomposition revealed three major and a few minor components. ...

Еще в разделе: (Показать все результаты (>27) - www.msm.biophys.msu.ru/ )

• MSM 2007

V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...

Еще в разделе: (Показать все результаты (>34) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/photos/achievements/asa_2013.pdf
• http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/weinstein09.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

In situ 3/04/2012 1 d =- i ( i d i ) d = + d ln s () ~ 1015 /2 ~ 10-9 /2 2 - . ... a = -2g 3 Furier-transformed infrared spectroscopy (FTIRS) ­ - - In situ - : - second harmonic generation (SHG) ­ ; - surface enhanced Raman scattering (SERS) ­ () Electromodulation infrared spectroscopy (EMIRS) ­ Subtraction normalized infrared spectroscopy (SNIFTIRS) ­ c Surface enhanced infrared absorption spectroscopy ( SEIRAS ) ­ 200 ­ 4000 -1 350 ­ 800 4 ...

Еще в разделе: (Показать все результаты (>38) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf
• http://www.elch.chem.msu.ru/kuznetsov/chizmadgev.pdf
• http://nanofluidics.phys.msu.ru/paper/prl2011.pdf

... A general approach to model these complex metabolic systems is suggested, Regulatory mechanisms in plant cell arc correlated with the different patterns of fluorescence induction curve at different internal physiological states of the cells and external (environmental) conditions, Light regulation inside photcsyntheric reaction centers, diffusion processes in thylakoid membrane. generation of transmembrane electrochemical potential. coupling with ... DEMII\ AKD A. RUBIN PS2 -s.. ...

Еще в разделе: (Показать все результаты (>26) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3371.pdf
• http://library.biophys.msu.ru/PDF/3344.pdf
• http://library.biophys.msu.ru/PDF/3341.pdf

... On Invariant Manifolds of Nonholonomic Systems Valery V. Kozlov * V.A. Steklov Mathematical Institute Russian Academy of Sciences ul. Gubkina 8, Moscow, 119991 Russia Received December 27, 2011; accepted January 23, 2012 Abstract--Invariant manifolds of equations governing the dynamics of conservative nonholonomic systems are investigated. ... 2 2012 ON INVARIANT MANIFOLDS OF NONHOLONOMIC SYSTEMS 135 We emphasize that the system of differential equations (2.3) is closed and has the form (1.6). ...

Еще в разделе: (Показать все результаты (>67) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/d42/1511.02655v1.pdf

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>24) - cellmotility.genebee.msu.ru/ )

... Асеев Н. Эфферентная копия активности нейронов в пищевом поведении виноградной улитки Helix pomatia L. Литературный обзор курсовой работы студента 4-го курса кафедры высшей нервной деятельности Биологического факультета МГУ. ... Connection of identified neurons in the buccal ganglia of Helix pomatia. ... Peters M Altrup U. Motor organization in pharynx of Helix pomatia. ... Роль гигантской серотонинсодержащей клетки церебрального ганглия виноградной улитки в организации пищедобывательного поведения....

Еще в разделе: (Показать все результаты (>98) - www.nature.web.ru/ )

• Научная Сеть - Scientific Network
• "Введение в криптографию" под редакцией В.В.Ященко
• Беталактамные соединения. Взаимосвязь структуры и биологической активности

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>3) - lab106.imec.msu.ru/ )

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>6) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>9) - observ.pereplet.ru/ )

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

159. About this document ...

160. http://selena.sai.msu.ru/Bus/Publications/ms38/ms063.pdf