... Finance - Currency Conversion . FXConverter - OANDA's 164 Currency Converter . ... PNAS Online -- Search Multiple Journals . ... Scirus - For Scientific Information Only . Molecular Biology Software . Education and Genetics: Human Genome Project Information . Journal of Computational Biology Table of Contents . LINK Alert Service - Subscribe . Springer LINK - Forum for Science . ... Genome Biol Vol. ... COMPUTATIONAL BIOLOGY . ... Journal Impact Factor 2000 . ...

Еще в разделе: (Показать все результаты (>88) - higeom.math.msu.su/ )

• Topology section
• S.P.Novikov Seminar

... Your girlfriend is ... than George's. much more beautifuler . ... Much of London ... by fire in the seventeenth century. destroyed . ... John prefers .... travelling by air to travelling on train . ... English, this year he .. ... Yesterday I bought a ... shirt. white new cotton . ... The professor said that .... the students can turn over their reports on Monday . the reports on Monday could be received from the students by him . the students could hand in their reports on Monday . ...

Еще в разделе: (Показать все результаты (>3) - anazarenko.ffl.msu.ru/ )

ARM . 12: Ї ARM 2 ARM Powered Products 3 ARM Ї 4 Ї ARM 32- . ARM : ґ Byte - 8 bits ґ Halfword - 16 bits ( ) ґ Word - 32 bits ( ) Ї ARM ґ 32-bit ARM Instruction Set ґ 16-bit Thumb Instruction Set 5 Ї ARM : ґ User : , ґ FIQ : , high priority (fast) ґ IRQ : , low priority (normal) ґ Supervisor : Software Interrupt instruction ґ Abort : ґ Undef : ґ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>5) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>3) - depni.sinp.msu.ru/ )

• ENSDF Relational

In situ 3/04/2012 1 d =- i ( i d i ) d = + d ln s () ~ 1015 /2 ~ 10-9 /2 2 - . ... a = -2g 3 Furier-transformed infrared spectroscopy (FTIRS) ґ - - In situ - : - second harmonic generation (SHG) ґ ; - surface enhanced Raman scattering (SERS) ґ () Electromodulation infrared spectroscopy (EMIRS) ґ Subtraction normalized infrared spectroscopy (SNIFTIRS) ґ c Surface enhanced infrared absorption spectroscopy ( SEIRAS ) ґ 200 ґ 4000 -1 350 ґ 800 4 ...

Еще в разделе: (Показать все результаты (>34) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf

... chief researcher G.N.Simkin , prof. I.R.Beme , researcher S.M.Smirenskiy , senior researcher N.D.Poyarkov , researcher V.B.Masterov , senior researcher M.Yu.Soloviev , researcher V.D.Anisimov , leading engineer M.N.Dementiev . ... chief researcher G.N.Simkin , prof. I.R.Beme , leading researcher V.M.Gavrilov , researcher A.B.Popovkina , senior researcher N.D.Poyarkov , researcher V.B.Masterov , senior researcher M.Yu.Soloviev , junior researcher E.N.Rahimberdiev , leading engineer M.N.Dementiev . ...

Еще в разделе: (Показать все результаты (>17) - vertebrata.bio.msu.ru/ )

Near-Infrared spectroscopic imaging of cardiovascular disease Kupriyanov V.V. Institute for Biodiagnostics, 435 Ellice Avenue, Winnipeg, R3B 1Y6, Canada, 1-204-9846620, Valery.Kupriyanov@nrc-cnrc.gc.ca Applications of near-infrared spectroscopic (NIRS) imaging to detection, localization and grading of acute cardiac ischemia and chronic infarction in pig models in vivo are described. ... NIRS imaging is well suited for intraoperative applications during coronary artery bypass surgery in humans. ...

Еще в разделе: (Показать все результаты (>24) - www.msm.biophys.msu.ru/ )

• http://www.msm.biophys.msu.ru/archive/doc14959/eng.pdf
• MSM 2007

CUDA Center of Excellence NVIDIA 22 ? ? ґ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - ? ? : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>8) - geophys.geol.msu.ru/ )

... Input parameters Key parameters: - sqrt(s), GeV N events ґ total number of events A number of target/projectile B min, B max ґ impact parameters (in fm) for all events Choice of parton-hadron conversion scenario (AMPT model, AMPT with string and others) Parameters for Lund fragmentation Quenching flag (on\off) K short decay flag, other flags Output parameters Output file: ampt.dat, containts: Event number Impact parmeter Total number of participants n. in proj. ...

Еще в разделе: (Показать все результаты (>31) - lav01.sinp.msu.ru/ )

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>13) - observ.pereplet.ru/ )

• theory1

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

158. http://www.intsys.msu.ru/staff/mazurenko/patents/US2015356708.pdf

159. http://www.msu.ru/work/GS_15.pdf

160. http://www.eng.math.msu.su/download/Academic_English_part2.pdf