... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>10) - ocean.phys.msu.ru/ )

... Design of small molecule antiviral compounds against tick-borne encephalitis, dengue fever, and other diseases caused by flaviviruses . ... K. N. Sedenkova, E. V. Dueva, E. B. Averina, Y. K. Grishin, D. I. Osolodkin, L. I. Kozlovskaya, V. A. Palyulin, E. N. Savelyev, B. S. Orlinson, I. A. Novakov, G. M. Butov, T. S. Kuznetsova, G. G. Karganova, N. S. Zefirov. Synthesis and Assessment of 4-Aminotetrahydroquinazoline Derivatives as Tick-Borne Encephalitis Virus Reproduction Inhibitors . ...

Еще в разделе: (Показать все результаты (>8) - qsar.chem.msu.ru/ )

• Molecular switches - Laboratory of Medicinal Chemistry
• Cytokinin Receptors - Laboratory of Medicinal Chemistry
• Home - Laboratory of Medicinal Chemistry

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...

Еще в разделе: (Показать все результаты (>19) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

... More Reports . ... Biphonation enhances a potential for individual recognition in the dhole ( Cuon alpinus ) // Advances in Ethology. ... Pack cohesion is very important for such collective hunters as the dholes, and is based, for the most part, on a repeated emission of especial calls. ... We have compared the impacts of the f and g components both independently and together into individual assignment of the biphonic calls in the dhole. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>49) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... 245, NO. ... Journal of Membrane Science 2005, 245 (1-2) 1-33 Jianhua Zou, Yongbin Zhao and Wenfang Shi. ... Journal of Membrane Science 2005, 245 (1-2) 3540 Aisheng Huang, Y.S. Lin and Weishen Yang. ... Journal of Membrane Science 2005, 245 (1-2) 41-51 Yi Li, Chun Cao, Tai-Shung Chung and Kumari P. Pramoda. ... Journal of Membrane Science 2005, 245 (1-2) 131-136 Dar-Jong Lin, Dong-Tsamn Lin, Tai-Horng Young, Fang-Ming Huang, Ching-Chung Chen and Liao-Ping Cheng. ...

Еще в разделе: (Показать все результаты (>123) - www.chem.msu.ru/ )

• Семинар "Перспективные наноматериалы"
• Program esrD

Exchanges Foreign partners . ... Foreign partners . International academic cooperaion of Moscow University is based upon inter-university agreements and memoranda, as well as by special protocols and working programs. ... Main International Exchange Partners of Moscow University (central level). ... University of Tirana . ... Universit t Salzburg . ... Germany . ... Italy . Universit degli Studi di Bari . ... Universit degli Studi di Firenze . ... International Relations Office 2007-2008 ...

Еще в разделе: (Показать все результаты (>4) - www.ied.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic . ... Academic Departments . ... Partners . ... All partners . ... Academic Options . ... The Department of Journalism offers Bachelor , Master or PhD degree in journalism and mass communications. ... Completing a Bachelor s degree programme in the Department of Journalism gives you a broad view of the media system and allows you to enter the journalism world with all the skills needed to be a professional. ... History of Journalism . ...

Еще в разделе: (Показать все результаты (>14) - www.journ.msu.ru/ )

• Title :: Department of Journalism, M. V. Lomonosov Moscow State University

... Первая десятка | ... Первая десятка "Русского переплета" Темы дня: . ... This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Tue Sep 23 14:45:21 MSD 1997 . Lipunov V.M. Tue Sep 23 14:45:21 MSD 1997 . ...

Еще в разделе: (Показать все результаты (>159) - www.pereplet.ru/ )

Заседание семинара по социофизике . ... These studies are based on the quantum-like paradigm (elaborated by the speaker): processing of information by complex context-sensitive systems has to be described by nonclassical probabilistic models: there is a plenty of statistical data which violate the laws of classical probability (or what is equivalent the laws of classical Boolean logic). ... Quantum-like modeling of cognition . ... Вебдизайн: Copyright (C) И. Миняйлова и В. Миняйлов . ...

Еще в разделе: (Показать все результаты (>7) - www.soc-phys.chem.msu.ru/ )

... Land Hydrology . ... Recreational Geography and International Tourism . ... Economic and Social Geography of Russia . ... Departments . ... Main accomplished research: River hydrology, limnology, hydrometry, water quality, flow hydraulics, hydrological predictions, fluvial processes, hydrophysics, hydrogeology, water management, water ecology. ... Large international conferences were organized by Hydrology Department for the last years – for example X Symposium on River Sedimentation (2007). ...

Еще в разделе: (Показать все результаты (>103) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Undergraduate study
• Renewable Energy Sources

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>56) - ffl.msu.ru/ )

• Наш факультет

EmTeX files . CHANGES.ENG CHANGES.GER DISKETTE.DOC HELP.ENG HELP.GER INSTALL.ENG INSTALL.GER QUICK.ENG QUICK.GER README.BET README.ENG README.GER . bibtex4b.zip bj_base.fli dj_base.fli dvid16h1.zip dvid16h2.zip dvisp10b.zip emtex .html emxrsx.zip fax_base.fli first.zip fontams.zip fontcm.zip fontec.zip fontemsy.zip fontltx.zip fx_base.fli german.zip install ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>12) - comphep.sinp.msu.ru/ )

• new-mac [CompHEP]

Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...

Еще в разделе: (Показать все результаты (>92) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf
• http://danp.sinp.msu.ru/pci2012/vecher29_2.pdf

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>12) - engineering.phys.msu.ru/ )

• Introduction to Linux

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>19) - shamolin2.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

2013. . ... 91­100 93 1: k +1 Vx k+1 Vy k+1 = k 1 0 0 Vx 0 1 0 · Vyk k 001 T 1 4 -1 4 -1 2(c + e) 2(c 1 1 1 4 4 4 1 1 -1 4 4 4 1 1 -1 + e) 2(c + e) 2(c + +2r tQ 1 2 · . 3) 3 e) 4 kT k k Vx +1 ,Vyk+1 , k+1 -- k + 1, Vx ,Vyk , k, -- k - sin k 0 cos Q = sin k cos k 0 0 0 1 xOy ; B = 2r 1 4 -1 4 -1 2(c + e) 2(c 1 1 1 4 4 4 1 1 -1 4 4 4 1 1 -1 + e) 2(c + e) 2(c + e ) [1], r -- , c -- , e -- , [1 ,2 ,3 ,4 ]T -- . ... Omni-directional mobile robot controller based on tra jectory linearization // Robot. ...

Еще в разделе: (Показать все результаты (>82) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

www.vovr.ru 1992 14 · 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...

Еще в разделе: (Показать все результаты (>6) - www.umo.msu.ru/ )