Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>8) - npidb.belozersky.msu.ru/ )

• NPIDB: List of complexes
• NPIDB: About Us

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>15) - suny.msu.ru/ )

... It is far easier: to apply for that type of visa one needs a voucher that can be issued by any travel/tourist agency in your home country (but better select an agency recommended by the appropriate Russian Consulate; please note that a hotel reservation even supported by a letter of invitation from the conference organizers is not sufficient to apply for a tourist visa, it is a voucher that is requested). ... 6) After getting the form, one can apply for the Russian visa. ...

Еще в разделе: (Показать все результаты (>18) - www.spa.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>67) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Unsolved problems and new prospects
• EEG feature extraction

Unitherm for Windows (version 4.5) Contents Unitherm for Windows compared to Unitherm for DOS 2 General comments 2 Limitations of Unitherm for Windows compared to Unitherm for DOS 2 Changes in Unitherm interface 2 New functionality of Unitherm for Windows 2 Specific features of Unitherm for Windows 3 Localization 3 Graphical user interface of Unitherm for Windows 4 The main ... mode. ... The window is opened with the List of reactions command of the Unitherm Reaction menu. ...

Еще в разделе: (Показать все результаты (>66) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Main.doc
• Software for resistivity and induced polarization
• Faculty of Geology >> Geology at Moscow State University

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

Unfaithful embedding of causal sets arXiv:1006.2320v1 [physics.gen-ph] 10 Jun 2010 Alexey L. Krugly Abstract In the causal set approach, spacetime is a continuous approximation of a faithful emb edded causal set. But the faithful emb edded causal set describ es the empty spacetime and cannot describ e matter. ... If we describe the elements of the faithfully embedded causal set as the vertices of the graph, and segments of the timelike curves as edges these vertices must have an infinite valency. ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_amplitudes.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>8) - acm.msu.ru/ )

... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>155) - ee-journal.spa.msu.ru/ )

... , Moscow, 119992 Russia Received November 3, 2006; in final form, November 21, 2007 Abstract--Further developing the method for direct multiparticle modeling of electron transport in the thylakoid membrane , here we examine the influence of the shape of the reaction volume on the kinetics of the interaction of the mobile carrier with the membrane complex ... Fig. ... We have previously outlined a direct multiparticle model of electron transport processes in the thylakoid membrane [21, 22...

Еще в разделе: (Показать все результаты (>30) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80524.pdf
• Effect of Hydration on the Structure, Dynamics and Function of Photosynthetic

... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...

Еще в разделе: (Показать все результаты (>13) - hcs.cmc.msu.ru/ )

• Master program "Decision Engineering in Economics and Finance" | Магистерское и
• Master program "Information Security and Cryptography" | Магистерское и
• Master Education | Магистерское и послевузовское образование Entrance

Прогнозирование утечки радионуклидов из подземного могильника WIPP в биосферу, США. ... Представлен обзор результатов оценки возможной утечки в биосферу радионуклидов из подземного эксперим. могильника трансурановых РО ВПК США WIPP с учетом геологич. разрезов, обрушения и трещинообразования в коренной породе (соляной пласт) площадки могильника. ... Представленные результаты свидетельствуют о незначительности вклада нарушений коренной породы в расчетную оценку радиоактивной утечки из могильника. ...

Еще в разделе: (Показать все результаты (>16) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=30&from=&ref_ind=1105004095

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... Итак, в каких же продуктах найти антиоксиданты, защищающие наши клетки от старения и сохраняющие нам молодость? Норвежские ученые предлагают на выбор свыше трех тысяч 'эликсиров молодости' на любой вкус. ... Our objective was to develop a comprehensive food database consisting of the total antioxidant content of typical foods as well as other dietary items such as traditional medicine plants, herbs and spices and dietary supplements. ...

Еще в разделе: (Показать все результаты (>358) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Таблетки замедляющие процесс старения уже в продаже.
• Клуб выпускников МГУ: Кайя Кальпа: продление жизни и бессмертие
• Клуб выпускников МГУ: В крови нашли 22 биомаркера старения

... Полная версия этой страницы: Аспирантура в США . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Academic requirements will be completed as part of the Applied Mathematics Program. ... Application information is at:http://www.memphis.edu/gradcatalog/d...g/cas/math.php. ... Applications will be considered as they are received, but not later than December 31, 2011. We look especially for prospective PhD students, but applications for Master's level will be considered as well. ...

Еще в разделе: (Показать все результаты (>448) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > PhD positions in Switzerland
• Студенческий форум Физфака МГУ > Помогите, пожалуйста, скачать статьи
• Студенческий форум Физфака МГУ > Новый журнал Call for Papers

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>25) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Brockett.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/KolesovMishchenkoRozov.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>15) - www.issp.ac.ru/ )

• IO of EAAS, Problems to solve (In Russian)

email: antonov_ai_@mail.ru) , , , , , , , , , , demographic situation in the world and in Russia, depopulation, declining fertility, srednedetnaya family crisis family functions, family and population policy, Reproductive behavior, the need for children, reproductive motivation, demographic projections 2070 . ... The focus on activation of demographic policy in Russia should focus on raising fertility, to increase the proportion of families with three or four children to 50 percent. ...

Еще в разделе: (Показать все результаты (>42) - vestnik.socio.msu.ru/ )

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , accepted to MNRAS (arXiv:1002.2360) . ... K-Corrections in the optical and near-infrared , Analytical approximations of K-corrections in optical and near-infrared bands , photometric properties of galaxies , K-corrections approximation redshift and one observed colour , transform observed spectral energy distributions (SED) , software to estimate K-corrections , ...

Еще в разделе: (Показать все результаты (>10) - kcor.sai.msu.ru/ )

• K-corrections calculator