... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>201) - ee-journal.spa.msu.ru/ )

My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>14) - www.rochesterastronomy.org/ )

• Supernova 1999gp in UGC 1993

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

• Postdoctoral training of foreign scientists at Physical Department
• Postdoctoral training (General Physics and Wave Processes)
• Postdoctoral training (Neutronography)

The Chair of Mathematical Theory of Intelligent Systems and . ... Magazine . ... Web archive . Magazine archive: electronic versions of last magazine issues in PDF format . ... General problens of Intelligent systems theory . ... Keywords : "Big history"; informatization; information-evolutionary approach; intelligence natural, artificial; intelligence computing, computer, technical; modelling; systems anthropogenous, anthropomorphous, intelligent, material . ...

Еще в разделе: (Показать все результаты (>111) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Research
• Intelligent Systems :: Staff :: Zhuk Dmitriy
• Options

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>8) - mph.cmc.msu.ru/ )

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>2) - np-chair.sinp.msu.ru/ )

Кафедра ТЕОРИИ ВЕРОЯТНОСТЕЙ БОЛЬШОЙ СЕМИНАР КАФЕДРЫ ТЕОРИИ ВЕРОЯТНОСТЕЙ Руководитель - академик РАН, профессор А. Н. Ширяев 20 марта А.Н. Ширяев A quickest detection problem with an observation cost Резюме. МГУ ) In the classical quickest detection problem, one must detect as quickly as possible when a Brownian motion without drift "changes"into a Brownian motion with positive drift. The change occurs at an unknown "disorder"time with exponential distribution. ...

Еще в разделе: (Показать все результаты (>82) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk_19_3.html
• http://new.math.msu.su/department/probab/spec/Materialy_po_kursam_Tutubalina/Finstat/Bashelie/Bachelier100years.pdf
• http://new.math.msu.su/department/probab/bsk_22_12.doc

The opinion of the members of the Russian Rectors ' Union delegation of the results of the Fourth All- Russian Students ' Forum The Vice-president of the Russian Rectors ' Union, Chairman of the Council of Rectors of higher educational institutions of the Siberian Federal District and the Novosibirsk region, Rector of Novosibirsk State Technical University N.V. PUSTOVOY: The participation of the Russian ...

Еще в разделе: (Показать все результаты (>36) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/2012_09_18/3.pdf
• http://www.rsr-online.ru/doc/norm/273.doc

Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain ? The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev1, V. I. Rodionov2, I. V. Maly1 and G. G. Borisy2,* 1Laborator 2Laborator y of Cell Motility, A. N. Belozersky Institute, Moscow State University, Moscow, Russia y of Molecular Biology, University of Wisconsin, 1525 ... Distal (plus) ends of MTs displayed dynamic instability. ...

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/alieva94.pdf
• http://cellmotility.genebee.msu.ru/html/articles/jcs.pdf
• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>351) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Три тысячи продуктов для продления молодости
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>36) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf

JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin Є Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...

Еще в разделе: (Показать все результаты (>21) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQC70.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQCh_04.pdf

Описание вакансии: . ... Key Account Manager, Russia CIS . ... Manage the overall profitability of product sales to the customer. ... следующая вакансия . список всех вакансий . добавить вакансию . редактировать эту вакансию . ...

Еще в разделе: (Показать все результаты (>54) - www.chemport.ru/ )

• "Sbr process specialist for lg chem, korea" - вакансия в разделе "Работа для
• атмосферно-вакуумные разгонки D 2892 - D 5236 Minidist Plus C Gecil Process
• Crisis processes in russia. anti-recessionary measures. консалтинг

PHYSICAL REVIEW B VOLUME 54, NUMBER 3 15 JULY 1996-I dc-electric-field-induced second-harmonic generation in Si,,111.. ... Optical second-harmonic generation SHG is a sensitive tool for studying the characteristics of buried solid-electrolyte and solid-solid interfaces, as has been demonstrated in a number of experiments.1ґ3 The SHG technique was shown to be extremely sensitive to the structural symmetry,4ґ6 and steps and kinks on vicinal surfaces,7ґ9 as well ... 8 E 0 scL d / d int 0 . ...

Еще в разделе: (Показать все результаты (>26) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/04_JETP98_THG.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/03_PRB68_073307.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/99_PhysRevB_60.pdf

... 209 ґ 212 209 THE ROLE OF THE NATIVE POND ODOR IN ORIENTATION OF THE GREEN TOAD (Bufo viridis LAUR.) YOUNGS-OF-THE-YEAR V. V. Shakhparonov1 and S. V. Ogurtsov 1 Keywords: toadlets, orientation, native pond odor, buffer zone, periods of learning. ... Individuals from the "buffer" zone prefer the native pond water during a week before the beginning of dispersal (as described by a distribution stability coefficient S; Fig. ... The latter are, probably, individuals ready for dispersal. ...

Еще в разделе: (Показать все результаты (>53) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/pub07_waterbirds_part3.3.1.2.pdf
• http://vertebrata.bio.msu.ru/Shedlock_Okada_2000_BE.pdf
• http://vertebrata.bio.msu.ru/Curlew_Sandpipers_Calidris_ferruginea_on_their_breeding_grounds.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>15) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

... Synchronous Evolution of Galaxies in Groups: NGC 524 Group O. K. Sil'chenko and V. L. Afanasiev 245 ISSN 1990-3413, Astrophysical Bulletin, 2012, Vol. ... Four of the five galaxies revealed synchronized bursts of star formation in the nuclei 1ґ2 Gyr ago. The only galaxy, in which the ages of stellar population in the nucleus and in the bulge coincide (i.e. the nuclear burst of star formation did not take place) is NGC 502, the farthest from the center of the group of all the galaxies studied. ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/ar281.pdf
• http://sn.sai.msu.ru/~sil/preprints/ic3653.pdf

... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectralґ time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...

Еще в разделе: (Показать все результаты (>47) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf
• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>7) - hep.phys.msu.ru/ )