... More Reports . ... The role of the native pond odour in orientation of the green toad (Bufo viridis) youngs-of-the-year // 12 th Ordinary General Meeting of Societas Europaea Herpetologica. ... Youngs-of-the-year with rudiments of tail keep within 1 m from the water body of the native pond and when disturbed escape to the pond. These toadlets tested in pair-choice conditions prefer water from the native pond compared with water from the strange one. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>75) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... All circuit parameters have been presented in a symbolic form. ... To use the program you will need a CIR file (PSpise, DesignLab file) of your circuit. CIR file examples have been enclosured: bpasside.cir, test1.cir, test2.cir, test3.cir, test4.cir, laksamp.cir, bridge.cir, uA741acf.cir, quartz.cir. ... Ideal operational amplifier (nullor) * Nname n1 n2 n3 n4 * * In the ideal op amp data, (n1,n2) represent output nodes, * (n3,n4) represent input nodes (noninverting, inverting). ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

• Symbolic matrix processor

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>47) - genphys.phys.msu.su/ )

• To Do List History

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>12) - mouse.belozersky.msu.ru/ )

• Geometrical core
• PLANdbAffy: probe-level annotation database for Affymetrix expression

... Karlsruhe Institute of Technology (KIT) . 76021 Karlsruhe/Germany . ... Most technological applications of crystalline materials are based on the modification of their microstructure (e.g. of their grain size and/or of the topology of different phases that may be present). ... Glasses with this microstructure will be called poly-glasses in analogy to poly-crystals). ... Professor , Institute of Materials Science, University . ... Founding Director and Senior Member of the Institute of New . ...

Еще в разделе: (Показать все результаты (>172) - www.chem.msu.ru/ )

• Dmitriy Mendeleev Online

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>3) - cytol.bio.msu.ru/ )

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>9) - www.biophys.msu.ru/ )

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>10) - www.rlcentre.com/ )

... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...

Еще в разделе: (Показать все результаты (>6) - lab106.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• ConClus

... Widgetkit is the next generation tool set for Joomla and WordPress. ... All widgets make use of modern web technologies like HTML5 markup, CSS3 features and jQuery based JavaScripts. ... It supports touch gestures and makes use of smooth CSS3 animations. ... Semantic HTML5 markup . ... You can create, edit or delete all widgets and their content in one place. ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>11) - physcontrol.phys.msu.ru/ )

• List All Categories
• Icons

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ґ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>29) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf
• http://www.mse-msu.ru/CV_Edoardo_Reviglio.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Text_Eng.pdf

Journal Search . Welcome to the Search Page. You can find publications of our laboratory here. ... 1.Author . All Bochenkova A.V. Dobrogorskaya Ya.I. Ermilov A.Yu. Firsov D.A. Granovsky A.A. Grigorenko B.L. Moskovsky A.A. Nemukhin A.V. Skasyrskaya E.Ya. ... J. Phys. Chem.Phys.Lett. ... J.Chem. ... Science J.Chem. ... Theochem) J.Phys.Chem.A J.Phys.Chem.B Mendeleev Communications Molec.Phys. Phys.Rev.B Russian J. of Phys. Chem. ... All 2002 2001 2000 1999 1998 1997 1996 1995 1994 . ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

• Current Projects
• Laboratory of Chemical Cybernetics

... Faculty of Physics . ... MSU Physicists (Prof. V.S. Chernysh, Dr. A.E. Ieshkin, Faculty of Physics, and Senior Researcher Yu.A. Ermakov, Scobeltsyn Nuclear Physics Research Institute, MSU) discovered a new mechanism of sputtering with cluster ion beams. A cluster is an assembly of atoms or molecules which quantity is in range from a few up to a few tens of thousands units per cluster. ... Recent decades, interaction of cluster ions with solids has been under extensive investigation. ...

Еще в разделе: (Показать все результаты (>265) - phys.msu.ru/ )

• Публикации по истории факультета
• Задачи вступительных экзаменов

Site navigation: . ... Publications . ... SPDC Laboratory . ... This website uses Javascript for many elements such as the menus and page customization. ... Using a clever design of polarization optic, Italian researchers have successfully created four-level 'ququart' quantum states using the polarization and orbital angular momentum of single photons. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>141) - qi.phys.msu.ru/ )

• Sergei Kulik: List of major publications

.

Еще в разделе: (Показать все результаты (>65) - lav01.sinp.msu.ru/ )

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>14) - lhe.sinp.msu.ru/ )

• LHPR Homepage

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>116) - monkey.belozersky.msu.ru/ )

• About this project
• PDB entries containing domains of the family "Basic region leucine zipper"
• PDB entries containing domains of the family "Sigma-70, region 4"

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ