... Master . Master net Homepage . ... Ten years ago it was realized that robotic observatories boost the capabilities of astronomical observations of non-stationary and short-lived phenomena in the Universe. ... The first Russian robot-telescope MASTER was developed in 2002 and installed nearby Moscow. ... OAO MO "Optica" has mastered the production of such systems. The workshop is devoted to the results achieved by MASTER-net, that recently stretch over the globe from Blagoveshensk to Argentina. ...

Еще в разделе: (Показать все результаты (>195) - master.sai.msu.ru/ )

• Conference program
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists
• YaB-100 - Asteroid

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>147) - hbar.phys.msu.ru/ )

• Autobiography of Joseph Scaliger

... Sergey V. Borisov . ... Kaplan A.Ya ., Borisov S.V. , Zheligovsky V.A. Classification of EEG's of adolescents based on spectral and segment parameters for the purposes of schizophrenia diagnostics // Biological Psychiatry, 2005 (ISSN 0006-3223), submitted . Borisov S.V. , Kaplan A.Ya ., Gorbachevskaya N.L., Kozlova I.A. Structural organization of the EEG alpha activity in adolescents with schizophrenic spectrum disorders // Zh . ... Borisov S.V. , Gorbachevskaya N.L., Kaplan A.Ya . ...

Еще в разделе: (Показать все результаты (>46) - brain.bio.msu.ru/ )

... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...

Еще в разделе: (Показать все результаты (>6) - lab106.imec.msu.ru/ )

... Academic Programmes . ... NEW Dates Price . ... 4 weeks minimum . ... TUITION FEES . ... Full-Time Tuition - 2 6 academic hours per week : . ... Part-Time Tuition - 18 academic hours per week : . ... If paid in several installments, course fees are calculated at the rate of US $ 150 per week for full-time tuition and US $ 120 per week for part-time tuition. ... 1 Full-Time Tuition (24 academic hours per week) US $ 1 95 per week . ... Part-Time Tuition (20 academic hours per week) US $ 1 70 per week ...

Еще в разделе: (Показать все результаты (>29) - www.cie.ru/ )

• Study Periods :: Admissions :: CIE
• July ? August 2010
• July ? August 2011

The Department of Talented Youth Affairs and Professional Orientation . ... News . ... Older posts . Newer posts . Posted on 20.01.2015 by admin . ... Posted in News | ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... The videoconference was held as part of a new project of MSU ?University without Continue reading . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>107) - talant.msu.ru/ )

• admin | The Department of Talented Youth Affairs and Professional Orientation |
• Summer School of Science and Education, Moscow State University ?Lanat? | The
• Moscow State University and DLC Republic of Dagestan, the project MSU

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>479) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"
• Клуб выпускников МГУ: Канада инвестирует 1 млрд $ в систему контроля
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... MCCME, Moscow 3 papers and (a) English edition of the textbook "Probability", vol. ... Springer, Berlin, 2006. ... 4 C. Conferences (as a participant): · Plenary talk at the Conference on Probability Theory and Mathematical Statistics dedicated to the centenary of A. N. Kolmogorov (September 21­27, 2003, Tbilisi, Georgia); · Plenary talk at the Franco- Russian Colloquium Perspectives de coopґ ation en informatiques et mathґ er ematiques appliquґ ees (October 2003, Moscow ); · Plenary ...

Еще в разделе: (Показать все результаты (>40) - new.math.msu.su/ )

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>8) - optics.sinp.msu.ru/ )

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>37) - shg.phys.msu.ru/ )

• All Publications Info Pad
• Publications Keywords Search
• List of Publications

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>2) - bioinf.fbb.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>22) - www.chemport.ru/ )

• Branch review "rating retailers fmcg of russia august 2010" классификация
• Rating retailers fmcg of russia august 2011 маркетинговое исследование насосных
• Real estate market monitoring august 2011 дрсу складская недвижимость

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 1378 . c] volatile objects accessing . ... Re: [c] volatile objects accessing [ re: genom ] . ... Re: [c] volatile objects accessing [ re: monoid ] . ... Рейтинг: . ...

Еще в разделе: (Показать все результаты (>2917) - www.snto-msu.net/ )

• Хоккей ЧМ 2008 - Public forum of MSU united student networks
• Объявления о PhD, Postdoc, Schools, Confs etc. - Public forum of MSU united
• access - Public forum of MSU united student networks

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>10) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners
• MSU Science Park - Publicity

The Energy Spectrum of Primary Cosmic Rays by the Data of Tunka Cherenkov Array . S.V.Bryanski, Y.V.Vasilchenko, O.A.Gress, T.I.Gress, G.N.Dudkin, A.I.Klimov, V.S.Khlytchieva, L.A.Kuzmichev, B.K.Lubsandorzhiev, E.A.Osipova, V.N.Padalko, L.V.Pan'kov, Yu.A.Parfenov, P.G.Pochil, V.V.Prosin, Yu.A.Semeney . Proc. 24th ICRC, Roma, 1995, v.2, p.724 . The First Results of TUNKA-13 EAS Cherenkov Light Experiment . ... Tunka EAS Cherenkov Array - status 2001 . ... 1) SINP MSU, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>8) - dbserv.sinp.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>20) - observ.pereplet.ru/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

• List of Publications of Prof. Alexander P. Seyranian