Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>343) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"
• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Три тысячи продуктов для продления молодости

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>5) - www.dubinushka.ru/ )

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ­ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ­ Blocking: ­ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI «-» () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

Nd:YAG .. ... E-mail: onov@mail.ru 1 Creation of laser-induced morphology features in a different ambient, particularly air and vacuum, by a 532 nm nanosecond Nd:YAG laser on crystalline silicon is reported. ... Nd:YAG 532 . ... Nd:YAG 10 , 10 . ... 10 10000. LIPSS), , . ... 1. : a - 2 (LIPSS) 530 (0,5 / , , 3000 ), b - 2 2 (3 / , , 10000 ), c - (1 / , , 10000 2 ) d ­ (0,7 / , , 3000 ). (. 1) 530 20 3000 0,5 /2, . ... V. Craciun, D. Craciun, Appl. Surf. Sci. ... Phys. 88 (2000) 1638. ...

Еще в разделе: (Показать все результаты (>154) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• A.M.Baldin
• Определение расстояния между источником и детектором

... Data . ... Coronas-Photon . ... Solar energetic particles . ... Nucleon . ... Coronas-Photon (Russian: Коронас-Фотон) or Complex Orbital Observations Near-Earth of Activity of the Sun, is a Russian solar research satellite. ... The goal is to investigate the processes of free energy accumulation in the sun's atmosphere, accelerated particle phenomena and solar flares, and the correlation between solar activity and magnetic storms on Earth. ... protons ( 4 - 80 MeV ) . ... particle energies, MeV . ...

Еще в разделе: (Показать все результаты (>41) - smdc.sinp.msu.ru/ )

• COHO project - Space monitoring data center
• Universitetsky-Tatyana - Space monitoring data center
• APEV service - Space monitoring data center

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

• Inter-Congress Meetings

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>24) - hea.phys.msu.su/ )

• Call for Papers
• Conference Policies

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>82) - qi.phys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Doklady Biological Sciences, Vol. 375. 2000, pp. ... GENERAL BIOLOGY Specific Structural Features of the Pectoral Arch and Phylogenetic Relations in Some Mammalian Taxa S. V. Fomin and V. S. Lobachev Presented by Academician I.A. Shilov March 6, 2000 Received March 6, 2000 Reorganization of the pectoral arch has played an important role in mammalian evolution. ... Thus, the formation of two types of pectoral arch in the modern families of Lagomorpha could only have occurred through divergence. ...

Еще в разделе: (Показать все результаты (>59) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Shedlock_Okada_2000_BE.pdf
• http://vertebrata.bio.msu.ru/pub07_waterbirds_part3.3.1.2.pdf
• http://vertebrata.bio.msu.ru/Samgina_et_al_2009.pdf

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>7) - td.chem.msu.ru/ )

• TernAPI program Laboratory of Chemical Thermodynamics

VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...

Еще в разделе: (Показать все результаты (>83) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>75) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Courses%20overview.pdf
• http://www.mgubs.ru/images/Image/IFP%202011%20brochure.pdf
• The Ljubljana Summer school

... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...

156. http://chaos.phys.msu.ru/loskutov/PDF/Letter_to_editor.pdf

157. http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_2.pdf

158. http://ics.org.ru/upload/iblock/970/119-some-comments-to-the-paper-by-a-m-perelomov-quot-a-note-on-geodesics-on-ellipsoid-quot-rcd-2000-5-1-_ru.pdf

159. Laboratory of laser spectroscopy of solutions of supramolecular compounds and

160. Кафедра общего и сравнительно-исторического языкознания филологического