... Company Presentation, Workshops & Evening Reception Wednesday 30th September 2009, 14:30 - 19:30 Sheraton Palace Hotel Moscow, Rooms St.Petersburg 1-2 The presentation will give you an insight in our business model, our culture. Workshops will provide you with information on how to apply for full-time positions and internships. ... To register for the event, please apply online at www.barcap.com/expectexcellence and select "Moscow" as the location in your application. ...

Еще в разделе: (Показать все результаты (>42) - www.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GEOLOGY%20GEOCRYOLOGY.pdf

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>5) - hep.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: Home

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>26) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Department of General Physics and magneto-ordered matter. Physics Department of

... Malkhazova S.M. (ecology, medical geography), Doctor of Geography. ... Biology, Ecology with the fundamentals of biogeography , Biogeographic basis for nature conservation, Mathematical methods in biogeography , Methods of field studies, Diversity of organisms, Ecology of human, Biogeographical mapping , GIS in biogeography and ecology , Ecology of organisms, Biogeography of foreign countries, Biogeography of Russia, Bioindication and Biomonitoring, Geography of utilization of ...

Еще в разделе: (Показать все результаты (>39) - eng.geogr.msu.ru/ )

• ICCE events
• Department of Oceanology

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>7) - top.sinp.msu.ru/ )

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>96) - higeom.math.msu.su/ )

... The SHG enhancement is attributed to the combined effects of the spatial localization of the fundamental field in the MC spacer and the fulfillment of the phase-matching conditions. ... AlGaAs,14 AlAs/AlGaAs,15 and ZnS/SrF2 (Ref. 16) layers, or alternating layers of porous silicon (PS) with different porosities.17,18 Several approaches are used for the calculation of SHG enhancement at the PBG edges of photonic crystals. ... For SHG enhancement at the PBG edge phase matching is even more important. ...

Еще в разделе: (Показать все результаты (>27) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/96_PhysRevB_54.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/02_AppPhysLett_81.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/01_JETP_73.pdf

... The Section of Geology train students in specialities: "Geological survey, search for and exploration of mineral resources deposits" (qualification "geologist") and "Oil and gas geology" (qualification "oil geologist"). In the limits of speciality "Geological survey, search for and exploration of mineral resources deposits" there is four specializations. ... Geological survey, search for mineral resources. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...

Еще в разделе: (Показать все результаты (>81) - www.geol.msu.ru/ )

• Faculty of Geology >> Geology at Moscow State University
• Кафедра Петрологии МГУ
• Software for resistivity and induced polarization

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... The number of randomly coinciding change-points (the noise level) can be easily estimated using the total numbers of change-points in each EEG channel, and thus the estimate of the number of systematically coinciding change-points can be cleared from the randomly coinciding change-points, both "true" and "false". ... This number, however, vary with the number of change-points in each channel. ...

Еще в разделе: (Показать все результаты (>63) - brain.bio.msu.ru/ )

• Change-point detection algorithm performance with real EEG
• Change-point synchronization in pairs of EEG channels

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf
• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf

... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...

Еще в разделе: (Показать все результаты (>19) - magn.phys.msu.ru/ )