. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . COLLABORATION .

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>48) - www.geol.msu.ru/ )

• Faculty of Geology >> Geology at Moscow State University
• Faculty of geology Moscow State Lomonosov University
• Faculty of Geology >> Departments

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>6715) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006
• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

Heat transfer intensification on surfaces with 'eddy generating' relief at supersonic velocity of incident flow . ... Temperature field on plates with 'eddy generating' relief (dimples and projections) М=3.1 . Local coefficients of heat transfer distribution on plates with 'eddy generating' relief (dimples and projections) and a smooth plate flown over by supersonic air stream M=3 . ... Temperature distribution during flowing of supersonic stream over a single dimple . ...

Еще в разделе: (Показать все результаты (>5) - termogaz.imec.msu.ru/ )

• staff_e

List of Publications . ... Odoulov S,Tarabrova T, Shumelyuk S, Naumova II, Chaplina TO: Photorefractive response of bulk periodically poled LiNbO 3 :Y:Fe at high and low spatial frequencies. ... Evlanova N.F., Naumova I.I., Chaplina T.O., Blokhin S.A. and Lavrishchev S.V. Periodically poled Y:LiNbO 3 single crystal: impurity distribution and domain wall location, Journal of Crystal Growth, Vol. 223, ? 1-2, pp 156-160 (2001). ... Phys. Rev. Lett., 86, pp 4021-402 (2001). ...

Еще в разделе: (Показать все результаты (>2) - newcryst.phys.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

... 1984: Department of Structural and Applied Linguistics, Philological Faculty, Moscow State University; M.A. earned in June 1984. ... 2003, Habilitation report: Analiz diskursa v kognitivnoj perspektive (Discourse analysis in a cognitive perspective) [ pdf ]. Institute of Linguistics RAN. 90 pp.. ... Cognitive Lingustics Association (since 1997). ... Cognitive Linguistics (Berlin, Mouton de Gruyter), 1997 ? ... Popularization of the advances in linguistics and cognitive science on Russian TV. ...

Еще в разделе: (Показать все результаты (>191) - www.philol.msu.ru/ )

• Московское типологическое общество :: МГУ :: Филфак :: ОТиПЛ
• II International Congress of Russian Language Researches - Information letter
• Second International Linguistic Olympiad (2004) :: МГУ :: Филфак :: ОТиПЛ

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ CHARACTERISTICS OF THE SEA SURFACE DISTURBANCE INDUCED BY THE RAYLEIGH WAVES Shusaku Inoue and Tatsuo Ohmachi Tokyo Institute of Technology, Department of Built Environment, Japan E-mail: shusaku@enveng.titech.ac.jp 1. ... The Rayleigh wave generates the sea surface disturbance which propagates faster than tsunami waves. ...

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION
• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... Projectile proton energies are above 300 keV Scattering angles are of fractions of mrad . ... C.D. Lin) FBA Exact representation of the amplitude so called paraxial approximation for fast proton Exact representation of the amplitude Basis for SBA and EWBA Integral representation of EWBA (eikonal) Integral representation of the FBA CALCULATIONS: Charge transfer Hong-Keun Kim et al Phys . Rev. A 85, 022707 (2012) Powerful note All helium wave functions, both ... Phys. Rev. A 71 (2005), 12706. ...

Еще в разделе: (Показать все результаты (>11) - lmmqsp.sinp.msu.ru/ )

• http://lmmqsp.sinp.msu.ru/mat/poster_Bulychev_2013.pdf
• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

Lomonosov project . ... Personnel . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Affiliation Moscow State University, Sternberg Astronomical Institute . ... Fax 7 495 939 5063 . ... Institute for Biomedical Problems of the Russian Academy of Sciences, Skobeltsyn Institute of Nuclear Physics of Moscow State University. ...

Еще в разделе: (Показать все результаты (>20) - lomonosov.sinp.msu.ru/ )

• Collaboration | Университетский спутник "Ломоносов"

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>56) - imaging.cmc.msu.ru/ )

... Next: Addition and Subtraction of Up: Data Analysis (Operations Menu) Previous: Fourier Transform Contents Index . The Command Histogram leads to the appearance of the Window, which present the distribution of individual points of the surface over its height. ... By Menu Command Histogram/ Cutoff the height of each point which is outside the vertical lines becomes equal to the height pointed by the corresponding vertical line. ...

Еще в разделе: (Показать все результаты (>42) - www.spm.genebee.msu.ru/ )

• AFM OF RNA AND RNA-PROTEINS COMPLEXES
• Igor Yaminsky's homepage
• bacteria1

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>5) - www.moip.msu.ru/ )

... Senior Lecturer, Chair of General Physics, Physical Department, Moscow State University; Ph.D. Igor I. Vlasov . Senior Researcher, Center of Research in Natural Sciences, Institute of General Physics of RAS; Ph.D. Igor G. Persiantsev . ... The Nesmeyanov Institute of Organoelement Compounds of Russian Academy of Sciences. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>22) - rswater.phys.msu.ru/ )

V.S. Chernysh, A.A. Haidarov, V.S. Kulikauskas. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, V.A. Kurnaev, E.S. Mashkova, V.A. Molchanov. ... В.С. Куликаускас, Е.С. Машкова, В.А. Молчанов, А.А. Хайдаров, В.С. Черныш, В. Экштайн. ... Поверхность, 1999, ?4. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov. ... V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov, A.A. Haidarov V.S. Chernysh and W. Eckstein. ... Поверхность. ...

Еще в разделе: (Показать все результаты (>4) - physelec.phys.msu.ru/ )