... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы . Курсы факультетов МГУ . Факультет иностранных языков и регионоведения . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...
... Construction of generating polynomials for residue codes of degrees 5-8 . ... Feynman integrals on functionals of the exponential type with polynomial degree . ... Complexity of realization of multi-valued logics functions by formulas of special type . ... Short trigonometric sums with not integer degree of natural number . ... One-dimensional liquid flow through a porous frame under interactive loads of the Darcy type and front pressure . ... Toggle formulas format . ...
Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf -- 236.9 Кб -- 06.02.2015 Похожие документы
... Актуальная информация . ... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ...
... Oxidative phosphorylation and respiratory control phenomenon in Paracoccus denitrificans plasma membrane. ... Changes in respiratory activity, transmembrane electric potential, and ATP synthesis as induced by additions of limited amounts of ADP and P(i) to tightly coupled inverted (inside-out) Paracoccus denitrificans plasma membrane vesicles were traced. ... The data support the kinetic mechanism of the respiratory control phenomenon. ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...
Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...
... education . research . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . educational program . ... Exam . ... Pass/fail exam . ... Fabrication Techniques of Polymers and Polymer Composites . ... Pass/fail exam, exam . ... Research Projects (as a Course Paper under laboratories and fields ), 9 weeks. ... Research and Diagnostic Methods of Nanoobjects and Nanosystems . ... Diagnostic Methods of Polymers and Polymer Composites . ... Research and Teaching, 6 weeks. ...
... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... The level of expression in Escherichia coli cells and different steps of purification of the recombinant NADP(+)-dependent formate dehydrogenase (EC 1.2.1.2, FDH) from bacterium Pseudomonas sp.101 was analyzed by rapid SDS-Gel capillary electrophoresis (SDS-Gel CE) and compared with SDS polyacrylamide gel electrophoresis (SDS PAGE). ... The molecular mass of the purified FDH was determined as 44,078 Da by matrix-assisted laser desorption/ ionisation time of flight mass spectrometry. ...
... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...