LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>4) - www.phys.msu.ru/ )

... Volodkin D.V., Balabushevitch N.G., Sukhorukov G.B., Larionova N.I.. ... Biochemistry (Mosc)., 2003, v. 68, N 2, 236-241. ... Biochemistry (Mosc)., 2003, v. 68, N 8, 869-874. ... Balabushevich N.G., Larionova N.I. Fabrication and Characterization of Polyelectrolyte Microparticles With Protein. ... Balabushevich N.G., Zimina E.P., Larionova N.I. Encapsulation of catalase in polyelectrolyte microspheres composed of melamine formaldehyde, dextran sulfate, and protamine . ...

Еще в разделе: (Показать все результаты (>139) - www.enzyme.chem.msu.ru/ )

• Organometallic&Biomimetics
• Efremenko E.N.
• Kluwer Academic Publishers - Doklady Biochemistry and Biophysics

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>9) - uranus.sai.msu.ru/ )

• Linux on CLEVO 8750

... CLEANSOIL . ... Therefore, the system is applicable to the remediation of soil below buildings, roads, pipelines, railroads, etc, for both local and/or diffuse contamination, and even for preventive applications. to develop and to test an innovative, simple, easy to handle, applicable under existing infrastructures and cost-effective on-site and in-situ soil remediation method able to achieve a degree of soil remediation that allows its reutilisation for different purposes; . ... http://soil.msu.ru ...

Еще в разделе: (Показать все результаты (>21) - eco.soil.msu.ru/ )

• Norwegian-Russian cooperation in the border area

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Лаборатория углеродных материалов . ... физического факультета МГУ . имени М.В. Ломоносова . 17 ноября 2015г. Поздравляем Редекопа Евгения Владимировича ! ... Углеродных успехов и долгожданных открытий в новом году. 25 декабря 2014г. Запуск нового сайта лаборатории. ... Букунов Кирилл (рук. ... Копытина Татьяна (рук. ... Морозов Максим (рук. ... Ржевский Александр (рук. ... 15 февраля 2014г. Поздравляем Алексеева Андрея с поступлением в аспирантуру Физического Факультета МГУ! ... П. Кос (рук. ...

Еще в разделе: (Показать все результаты (>6) - carbon.phys.msu.ru/ )

• Лаборатория углеродных материалов - Наука
• Лаборатория углеродных материалов - Медиа
• Лаборатория углеродных материалов МГУ им. М.В. Ломоносова - Наука

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>108) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Institute of Numerical Mathematics of RAS . DRIVER: Study of 3-dimensional variability of water circulation, heat and salt fluxes of the World Ocean during the second half of the XX'th century by means of a high resolution numerical model . ... AREA: Informatics, Oceanology . ... Moscow State Uiversity . ... AREA: Informatics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>52) - hpc.msu.ru/ )

• CLEO: USER & ADMIN-FRIENDLY CLUSTER BATCH SYSTEM | Moscow University
• Octotron: Active Control for Reliable Functioning of Supercomputers | Moscow
• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...

Staff :: Strogalov Alexander Sergeevich :: Publications of A.S.Strogalov . ... Some requirements are settled to educational computer systems and there is given a description of the main units of the real acting educational system "IDEA for Windows" developed on the theoretic investigation results of authors' association . ... The structure and principles of the main units acting of computer educational system "IDEA for Windows" using expert system as "computer teacher" is described below. ...

Еще в разделе: (Показать все результаты (>88) - www.intsys.msu.ru/ )

• Intelligent Systems :: MaTIS Chair :: Information
• Intelligent Systems :: Research
• Options

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• ConClus

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

. Selected Photos . The Einstein field equations (Bolivia) . Salt Lake (Bolivia) . The Temple of Heaven (Beijing, China) . Machu Picchu (Peru) . Alpamayo (Cordillera Blanca, Peru) . Stone Garden (Kyoto, Japan) . Sugar Loaf (Rio de Janeiro, Brazil) .

Еще в разделе: (Показать все результаты (>32) - mailybaev.imec.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... World Data Systems functions under the sponsorship of the International Council for Science ICSU since 1956 (until 2008 in the form of two structures - World Data Centers and the Federation of Astronomical and Geophysical Data Analysis Services). ... Map "The population of the Russian Federation", scale 1:7 500 000, Russian Geographical Society, Faculty of Geography Moscow State University, OOO "FOC", 2014. ...

Еще в разделе: (Показать все результаты (>56) - eng.geogr.msu.ru/ )

• Department of Land Hydrology
• Recreational Geography and Tourism
• Undergraduate study

Sorry, Your browser does not support frames. To see context of this page you should update it. Sorry, Your browser does not support JavaScript. To see context of this page you should enable JavaScript or update browser.

Еще в разделе: (Показать все результаты (>17) - sbmg.geol.msu.ru/ )

• Calendar Converter

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>14) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>39) - shg.phys.msu.ru/ )

• Education Info
• Programs Grants Info
• International Cooperation Info