... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/zzx/11_2_en.doc
• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>15) - polit.msu.ru/ )

• Новости факультета

... Sunday, November 4, 2007 |4:30 - 6:30pm |Flight SU #303 arrives to |Pickup at Pearson Int'l Airport | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | Monday, November 5, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ... Tuesday, November 6, 2007 |7:00 - 8:00am |Breakfast |Executive Dining Room | ... 12:30 - 1:30pm | ... Wednesday, November 7, 2007|7:00 - 9:00am |Breakfast |Executive Dining Room | ... Thursday, November 8, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Oct28-Nov5_2007.doc

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>89) - chaos.phys.msu.ru/ )

• Staff
• Science

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql

Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Error: You currently have Javascript disabled. This website uses Javascript for many elements such as the menus and page customization. Please enable Javascript in your browser for the optimum website experience. ... Quantum information is encoded into polarization states created by frequency-nondegenerate spontaneous parametric down-conversion in collinear geometry. ... Download [ help ]: . ...

Еще в разделе: (Показать все результаты (>131) - qi.phys.msu.ru/ )

RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...

Еще в разделе: (Показать все результаты (>70) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>40) - uhecr.sinp.msu.ru/ )

• Publications on Transient luminous events
• Новости КЛПВЭ
• Publications UHECR

... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . ... Homepage > Admissions > . Study Periods . 2014-2015 academic year . ... One academic year programme: . September 2014 - June 2015 . Arrival Dates . ... August 28 October 31 . June 2015 . One and a half academic year programme: . ... STUDY PROGRAMMES AND COURSE DATES . ... September 20 15 - June 20 16 . ... Study Period . ... Recommended Arrival Dates . ... June 2 6 June 29 . ...

Еще в разделе: (Показать все результаты (>34) - www.cie.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... For lipid bilayer modelling the whole toolchain was built: from creating membranes to MD trajectory analysis. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... 4 комментариев " Lipid membrane MD modeling with GROMACS " . Python membrane generator for MD simulations ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 14th, 2012 4:11 пп) . ...

Еще в разделе: (Показать все результаты (>14) - erg.biophys.msu.ru/ )

• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• membrane ERG Research Group: Лаборатория теоретической биофизики

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>22) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>5) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>19) - heritage.sai.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Russia, Voronezh . ... Russia, Voronezh region, Voronezh . Form of education . ... Add information about education . МГУ имени М.В. Ломоносова . ... 119991, г.Москва, Ленинские горы, д.1, Главное здание МГУ . ...

Еще в разделе: (Показать все результаты (>65) - conf.msu.ru/ )

• Ульяна Сергеевна Баймуратова / МГУ имени М.В.Ломоносова

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: ? a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>2) - www.phys.msu.ru/ )