Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf -- 236.9 Кб -- 06.02.2015 Похожие документы
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...
[
Текст
]
Ссылки http://www.inorg.chem.msu.ru/matsci/hydrothermal/pdf/balakhonov_cv.pdf -- 32.2 Кб -- 01.02.2011 Похожие документы
Dmitri A. Timashev Torus actions of complexity one Let T = (Cв )r be a complex algebraic torus acting on an algebraic variety X . ... By Sumihiro's theorem X = Xi is covered by finitely many affine open T -stable subvarieties. ... The normal affine T -varieties of complexity 1 are in a 11 correspondence with the hypercones. ... Conclusion: Normal T -varieties of complexity 1 are in a 11 correspondence with finite collections of hypercones intersecting in their common hyperfaces, called hyperfans. ...
[
Текст
]
Ссылки http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf -- 74.5 Кб -- 29.05.2006 Похожие документы
. При написании HTML на сайте вы можете использовать любые HTML-теги для создания нужных вам эффектов. Вы должны размещать код в ячейке таблицы, учитывая следующее: . ; . , который может нарушить структуру страницы сайта. Список всех файлов помощи . Show this help in language: English .
... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...
... Main features of PPC: positive, motivational therapeutic Gospel - departure from negative language towards human; loving, giving God-friend and helper; felt needs placed in the center of ministry; accent on positive human nature; theology becomes a mission of local congregation; Christian doctrine replaced with psychology, sociology, marketing; emergence of new, diverse organizational forms, modified religious practice and contemporary worship. ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2010/3/18.pdf -- 123.4 Кб -- 11.11.2012
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2010/3/18.pdf -- 123.4 Кб -- 12.01.2015 Похожие документы
Are this birds live in Russia? Sigg Tobias /nb /00 21 февраля 2002 18:42:26 . ... Im just wonder if you know what this birds are called in Russia?? I m making a bird list and translate them to 12 language but i cant find . this birds in russia.. ... Alectoris rufa . ... Acrocephalus melanopogon . ... Sylvia conspicillata . Sylvia melanocephala . ... Thank you verry much if you can help me and I wish good luck in the . olympic games for russia in Ichockey Thank you .. Tobias . ...
... Unit 1. Overview of Physics. ... 3-5 .10-11. ... Vocabulary p.15-17. ... Insight into Basics of Physics. ... 3-5 .9293. ... Active Vocabulary. ... Solving Physics Problems p. 95-96. ... 1-3 .114. ... Functions of "it", "that" and "one" in a sentence. ... Vocabulary Work p.134135. ... 136; 5 (1-4) . ... 118 . ... Major Discoveries in Physics and Top Physicists of All Time. ... 1-3 .173-174 : .1 . ... 192 (1-4). ... 190-191 2 192- . ...
... MIT OpenCourseWare (бесплатные учебные курсы Massachusetts Institute of Technology ) . ... UCSB CS140 - Parallel Scientific Computing: Winter 2007 . ... Scientific Computing for Engineers (Prof. Jack Dongarra, Department of Computer Science (CS) at the University of Tennessee, Knoxville) . Introduction to Finite Element Methods (ASEN 5007) Fall 2007 (Department of Aerospace Engineering Sciences, University of Colorado at Boulder) . ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...
Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...