... Plants . ... The study of structural and functional plant systems diversity at different levels (cell-to-biocenotic) will reduce the risk of violating the stability of the living systems in Russian Federation. Russian Federation plays a key role in the preservation and use of raw Arctic potential. The highest spore plants, as an essential component of plant communities in northern Holarctic are involved in the settlement of naked substrates, preservation of permafrost and bogging. ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

University Satellites and . Space Science Education . ... Coupling of Atmospheric Layers EU FP5 RTN Project: Engaging Scientists in Training and Outreach Activities . ... The educational 'training' programme work-package is a key ingredient in the CAL project and covers the implementation of the training activities aimed at the young scientists hired through the CAL project, as well as participating senior scientists. ...

Еще в разделе: (Показать все результаты (>47) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• UNIVERSAT-2006 presentations

Sp ecific features of differential motions in the DIMM V. Kornilov, B. Safonov May 28, 2010 1 Intro duction Differential image motion monitor DIMM widely used in studies of optical turbulence, is destined to measure the integrated effect of the Earth's atmosphere on the image quality. ... In the work of Martin, they are obtained by gradual spatial filtering 1 of the power spectrum of phase perturbations in the assumption of Kolmogorov's model of the optical turbulence (OT). ...

Еще в разделе: (Показать все результаты (>21) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/mass_spectral_band_eng.pdf
• atmos 3.0 page

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>6) - srd.sinp.msu.ru/ )

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

Geology at Moscow State University . Departments . Information for foreign students . ... Geology and geochemistry of ore deposits . Geology and geochemistry of oil and gas . ... Geology of Russia . Paleontology . ... Members of the Chair give lectures on Paleontology to students of the Faculty of Geology and to the 5-year students of the Faculty of Biology. Also the Chair is responsible for giving lectures on the course "Basics of Ecology" to students of the Faculty of Geology. ...

Еще в разделе: (Показать все результаты (>54) - www.geol.msu.ru/ )

• Кафедра Петрологии МГУ
• Page 3. Publications
• Near-surface electrical prospecting laboratory at Moscow University

Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline Ї Acceleration of particles at forward and reverse shocks in SNRs Ї Amplification of magnetic fields Ї Modeling of broad-band emission Ї Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...

Еще в разделе: (Показать все результаты (>5) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Shpiering.pdf

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>4) - mouse.belozersky.msu.ru/ )

... Диагностики Неорганических Материалов . ... СИНТЕЗ И ИССЛЕДОВАНИЕ МАТЕРИАЛОВ ДЛЯ ГАЗОВЫХ СЕНСОРОВ . ... Спектрометр AFS-2000, BAIRD . ... Ардашникова Е.И., Мазо Г.Н., Тамм М.Е. Вопросы и задачи к курсу неорганической химии.М.,Изд-во МГУ,2000.96с. РФФИ 01-03-32728 "Неоднородные системы на основе оксидов металлов в ультрадисперсном состоянии с высокой газовой чувствительностью" (рук. ... J.of Solid State Chemistry 149, 2000, 99-106 . ... J. for Inorganic Phospourus Chemistry, Vol.10, 1999, 194-198. ...

Еще в разделе: (Показать все результаты (>42) - www.inorg.chem.msu.ru/ )

... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...

Еще в разделе: (Показать все результаты (>43) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

173. Background? Faculty of Bioengineering and Bioinformatics, MSU

174. 39th INTERNATIONAL CHEMISTRY OLYMPIAD