Электронная библиотека Попечительского совета . ... Lewis H.G. - Effective E-Mail. The Complete Guide to Creating Successful Campaigns . ... Название: Effective E-Mail. ... Автор: Lewis H.G. Аннотация: . E-mail is the first force-communication phenomenon of the twentyfirst century. ... In fact, e-mail is an easier form of communication than speech, because the e-mail sender can catch and repair errors that readily slip out between the lips.) ...

Еще в разделе: (Показать все результаты (>23522) - lib.mexmat.ru/ )

• Kim K. - Electronic and Algorithmic Trading Technology: The Complete Guide ::
• Farr J.M. - Top 100 Computer and Technical Careers: Your Complete Guidebook to
• Lopez O. - 21 CFR 11: Complete Guide to International Computer Validation

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>110) - scon155.phys.msu.su/ )

V.I. Ivanov, M.K. Trubetskov . Handbook of Conformal Mapping with Computer-Aided Visualization . ... The book is a complete handbook on conformal mapping applications in mathematical physics. The book is supplied with IBM PC programs for Microsoft Windows for conformal mapping visualization and analysis. Conformal mappings are large and essential part of the complex analysis. ... Conformal mappings are included into all courses of studies of the complex analysis. ...

Еще в разделе: (Показать все результаты (>125) - srcc.msu.ru/ )

Msphinx . SPHINX (Satellite Process Handling Images uNder XWindow) is an efficient and intuitive image analysis and display system for satellite image processing needs. ... The new system design conserves the unique windowing scheme for displaying images but changes the depth and size of the internal data. ... Data Base and User Virtual Plane Structure . ... http://loasys.univ-lille1.fr/Msphinx/Msphinx_gb.html . ... SAL Home | Computer Graphics, Images Signals | Processing Visualization . ...

Еще в разделе: (Показать все результаты (>4223) - www.sai.msu.su/ )

• SAL- Computer Graphics, Images Signals - CAD, Drawing Painting Tools -...
• SAL- Computer Graphics, Images Signals - Modelers - Moonlight Atelier
• FTS Complete Tutorial

... Inhibitory effect of palmitate on the mitochondrial NADH:ubiquinone oxidoreductase (complex I) as related to the active-de-active enzyme transition. ... Taken together, these results suggest that free fatty acids act as specific complex I-directed inhibitors; at a physiologically relevant temperature (37 degrees C), their inhibitory effects on mitochondrial NADH oxidation is due to perturbation of the pseudo-reversible active-de-active complex I transition. ...

Еще в разделе: (Показать все результаты (>119) - biochem.bio.msu.ru/ )

• Effect of disulfide crosslinking on thermal transitions and chaperone-like
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

... About lab . ... Selected publications . Publications . ... Conference "GraphiCon" . Online Journal "Computer graphics and multimedia" (in russian) . ... Automatic building texture completion . Publication Type . Conference Paper . Year of Publication . ... Conference Name . ... Publication Language . ... http://graphics.cs.msu.ru/en/publications/text/gc2006kv.pdf . ...

Еще в разделе: (Показать все результаты (>864) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>4479) - monkey.belozersky.msu.ru/ )

• About authors ot this complex

Back to homepage >> . ... key words: [ melt inclusions, experiment, diffusion, boundary layer effect ] . ... In order to distinguish an influence of the boundary effects on the composition of melt inclusions, the experiment on growth of alkali feldspar (Fsp) crystal in the haplogranitic system (Q-Ab-Or) was performed. ... Estimation of an influence of the boundary effect on melt inclusion composition . ... The larger inclusion the weaker its influence on the boundary layer. ...

Еще в разделе: (Показать все результаты (>648) - geo.web.ru/ )

• The influence of boundary layer effects on the melt inclusions compositions.

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2215) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>947) - chem.msu.ru/ )

• The effect of salts on the rate constants for quenching of luminescence of
• Similarity and difference of exciplexes with complete and partial electron
• Ivan Sorokin

... Reduction of detailed schemes for chemical transformations of formaldehyde and hydrogen oxidation reactions based on a sensitivity analysis of a mathematical model" . ... The results of simulation are compared in the case of using a number of reduced and detailed schemes for formaldehyde and hydrogen oxidation reactions. Keywords: sensitivity analysis, mathematical model of reaction, formaldehyde oxidation reaction, hydrogen oxidation reaction, reduction of chemical reaction mechanisms. ...

Еще в разделе: (Показать все результаты (>260) - num-meth.srcc.msu.ru/ )

• "Computation of contribution from the cavity effect to protein-ligand binding
• "Calculation of optimal coefficients for quadrature formulas by the complete
• "A clipping method when rasterizing complex objects"

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>173) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

... Science . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich engineer, Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich professor, Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>178) - ofvp.phys.msu.ru/ )

... Research . ... Ionomer effect, polyelectrolyte gels, polyelectrolyte complexes, phase behavior of polyelectrolyte solutions. ... In this case some unusual effects originating from counterion association with ions on the gel subchains can take place. ... For counterions of intermediate size (TMA, TEA) charging of the gel causes first its swelling, then collapse and finally reswelling, when some degree of ionization is reached (polyelectrolyte - ionomer - polyelectrolyte switching). ... Kramarenko. ...

Еще в разделе: (Показать все результаты (>359) - polly.phys.msu.ru/ )

• P.N.S.P.M. Lab. - Collaboration
• P.N.S.P.M. Lab. - Publications
• NATO Scientific & Environmental Affairs

Laboratories \ Laboratory for Microevolution and Domestication of Mammals \ Publications . ... Publications . ... Bialowieza. 2002. 40 p. 2002 . ... 2002. ... Lavrenchenko L.A., Orlov V.N., Milishnikov A.N. Notes on chromosomal identification of rodent species in western Ethiopia. ... Lavrenchenko L.A., Verheyen E., Potapov S.G., Lebedev V.S., Bulatova N.Sh., ... 2005 . ... 2005, Р. 199-214. ... Lavrenchenko L.A. Possible karyological affinities of small mammals from north of the Ethiopian Plateau. ...

Еще в разделе: (Показать все результаты (>6184) - www.sevin.ru/ )

• Laboratories: Laboratory for Synecology: Publications
• Экологический Форум - Фундаментальная Экология: i just completed a whole
• Экологический Форум - Фундаментальная Экология: Over virtually the complete

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>7231) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>14788) - theory.sinp.msu.ru/ )

• Exact Solution for Nonintegrable Systems
• M.Z. Iofa Curriculum vitae.
• calg:dubna07:abstracts [THEP]

note for full txt file see comp-ful.txt) Doom Version: 1.9 (The Ultimate Doom) ================================================================ Title : Enigmatic Complex Computer Lab version 2.0 Filename : COMPLEX.WAD Author : Grimm Email Address : grimmssac@yahoo.com Misc. ... The DeHackEd patch changes the level names under the map. ... It is the first level of a new Doom. ... The "marble" area has 155 monsters. ... I also tried to align every texture (manually). ... New Music : Yes, from EP4B.WAD. ...

Еще в разделе: (Показать все результаты (>4494) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/d-f/dakills.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/r/rush/permanent.waves
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/g-i/infbeta.txt

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash- completion -r1 prefix toolchain-funcs DESCRIPTION= Programmable Completion for bash HOMEPAGE= http://bash- completion .alioth.debian.org/ SRC_URI= http://bash- completion .alioth.debian.org/files/${P}.tar.bz2 LICENSE= GPL-2 SLOT= 0 KEYWORDS= ~alpha amd64 arm ~arm64 hppa ...

Еще в разделе: (Показать все результаты (>17722) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-1.3-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.2.ebuild
• Index of /pub/gentoo-portage/app-shells/bash-completion/

HH111's 12 Light-Year Star Jet . ... HST , NASA . Explanation: The complex interactions of three stars in the Orion B molecular cloud complex have resulted in the ejection of particles along a 12 light-year long jet. ... The complete system is quite complex and involves another less-luminous jet and disks of rapidly rotation gas. ... Protons and electrons zip along near 500 kilometers per second in the HH111 jet, which is about 1500 light-years away. ... NASA Official: Jay Norris. ...

Еще в разделе: (Показать все результаты (>12268) - www.astronet.ru/ )

• A Complete Solar Cycle from SOHO
• A Complete Aurora
• Астронет > A Complete Aurora