... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>11) - theorphys.phys.msu.ru/ )

• Сарданашвили Геннадий Александрович

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCo literature in English

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>133) - www.fadr.msu.ru/ )

• THE POST-SIMPOSIUM EXCURSION (July 31 - August 7,1998)
• Proposition

Geology at Moscow State University . ... Our adjunct Professors . ... The faculty permanently extends the contacts with many overseas universities. The graduator of 1991 Artem R. Oganov who completed his PhD degree in University of London and now works as a leader of the group in ETH (Zurich) was recently nominated by the Faculty Scientific Council as an adjunct Professor. Prof. Dr. Artem R. Oganov . ... 2) Adjunct Professor, Geology Department, Moscow State University, Moscow 119899, Russia. ...

Еще в разделе: (Показать все результаты (>79) - www.geol.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Align tool for DNA-protein complexes

... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...

Еще в разделе: (Показать все результаты (>20) - hcs.cmc.msu.ru/ )

• Master program "Mathematical Models of Complex Systems" | Магистерское и

Hybrid Molecular Mechanics : For Effective Crystal Field Method for Modeling Potential Energy Surfaces of Transition Metal Complexes M. B. DARHOVSKII/-2 M. G. RAZUMOV/ A. L. TCHOUGREEFF12 1 3 I. V. PLETNEV,2' 4 L. Y. Karpov Institute of Physical Chemistry , Moscow , Russia 2 Center for Computational Chemistry at the M. V. Keldysh Institute/or Applied Mathematics of RAS, Moscow , Russia 3N. S. Kurnakov Institute of General and Inorganic ... 2002 Wiley Periodicals, Inc. ...

Еще в разделе: (Показать все результаты (>36) - analyt.chem.msu.ru/ )

• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>22) - www.cie.ru/ )

• Admissions :: CIE

... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>146) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU
• The Computer Systems Laboratory | CMC MSU
• The Computer Systems Laboratory

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>31) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/273.doc
• http://www.rsr-online.ru/doc/norm/354.doc

. This is the complete list of member functions and enum types for QNPStream , including all inherited members. QNPStream . complete . end . instance . lastModified . okay . requestRead . seekable . setComplete . setOkay . type . url . write . ~QNPStream . Copyright © 1998 Troll Tech . Trademarks . Qt version 1.40

Еще в разделе: (Показать все результаты (>605) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>142) - hist.msu.ru/ )

• Internet-Heuristics for Historians: Course on Web Search and Data Retrieval.

... Diffusion governed by Brownian motion is an efficient transport mechanism on short time and length scales. ... A Brownian particle will rapidly explore a heterogeneous environment that in turn strongly alters its trajectory. ... It is well known that the non-negligible fluid's inertia leads to hydrodynamic memory effects [1] resulting in a characteristic long-time tail of t -3/2 in the velocity correlations of the particle's motion. ... 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>72) - www.msm.biophys.msu.ru/ )

... On a Classification of Orbits for Cubic Differential Systems . M.Popa, E.Naidenova (Academy of Sciences, Institute of Mathematics and Computer Sciences, Kishinev, Moldova) . ... We consider a two-dimensional system of differential equations of the first order with polynomial right . ... Using the methods described in [1] the complete classification of orbits for linear representation of the group of rotations and Lorentz group in the space of coefficients of the cubic differential system is done. ...

Еще в разделе: (Показать все результаты (>292) - acs366.phys.msu.su/ )

• Abstract (Invited)
• AUTHOR : Neis U

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>21) - angel.cs.msu.su/ )

... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 > Modules . ... To enable mod_dav , add the following to a container in your httpd.conf file: . ... In addition, a location for the DAV lock database must be specified in the global section of your httpd.conf file using the DavLockDB directive: . ... In order for mod_dav to manage files, it must be able to write to the directories and files under its control using the User and Group under which Apache is running. ...

Еще в разделе: (Показать все результаты (>318) - itpm.msu.su/ )

• Hard disks
• The Linux Kernel (Copyright Notice)
• Preface

... Professor Yurii Naumovich Lipsky oversaw the preparation of the first ever maps of the far side of the Moon, of the whole Moon, and cartographic globes of the Moon. ... He was a professor, a doctor of physico-mathematical sciences, the founder of the Department of Lunar and Planetary Physics in GAISh and its first head. ... The first photographs of the far side of the Moon . ... He was the scientific supervisor of the study of the first photographs of the far side of the Moon. ...

Еще в разделе: (Показать все результаты (>90) - selena.sai.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

Inline search, shows a search result embedded in a topic . Syntax: %SEARCH{"text" .. ... BookView search, e.g. show complete topic text . Show topic summary . ... Exclude topics from search: A topic, a topic with asterisk wildcards, or a list of topics separated by comma. ... Sort the results of search by the topic names, topic creation time, last modified time, last editor, or named field of TWikiForms . ... Search topic name (title); the text (body) of topic; or all (title and body) . ...

Еще в разделе: (Показать все результаты (>34869) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (21 vs. 22) - TWiki
• VarSEARCH - TWiki - TWiki
• TWikiUISearchDotPm - TWiki - TWiki - (printable)

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>171) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!
• dead computer contest | С Днем Победы!