... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4196) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• Программы пакета BLAST
• Practice3

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>8693) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• Alex Makarov. Personal Page. Blast.

... Farr J.M. - Top 100 Computer and Technical Careers: Your Complete Guidebook to Major Jobs in Many Fields at All Training Levels . ... Название: Top 100 Computer and Technical Careers: Your Complete Guidebook to Major Jobs in Many Fields at All Training Levels . Автор: Farr J.M. Язык: . ... Armed Forces, job opportunities in 25 47-55 . ... Computer control programmers and operators 25 81-84 . Computer programmers 25 84-87 333 . Computer scientists and database administrators 25 87-90 . ...

Еще в разделе: (Показать все результаты (>11970) - lib.mexmat.ru/ )

• Frank B. - Complete Solutions Manual :: Электронная библиотека попечительского
• Looijenga E.J.N. - Isolated Singular Points on Complete Intersections ::
• Newton D. E., Olendorf D., Jeryan C. - U.X.L Complete Health Resource. Sick 4

... Semantics of Nonblocking Communications . ... The semantics of nonblocking communication is defined by suitably extending the definitions in Section Semantics of point-to-point communication . Order Nonblocking communication operations are ordered according to the execution order of the calls that initiate the communication. The non-overtaking requirement of Section Semantics of point-to-point communication is extended to nonblocking communication, with this definition of order being used. ...

Еще в разделе: (Показать все результаты (>508) - www.parallel.ru/ )

• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по
• Return status | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Progress | PARALLEL.RU - Информационно-аналитический центр по параллельным

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>106) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash- completion -r1 prefix toolchain-funcs DESCRIPTION= Programmable Completion for bash HOMEPAGE= http://bash- completion .alioth.debian.org/ SRC_URI= http://bash- completion .alioth.debian.org/files/${P}.tar.bz2 LICENSE= GPL-2 SLOT= 0 KEYWORDS= ~alpha amd64 arm ~arm64 hppa ...

Еще в разделе: (Показать все результаты (>17317) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-1.3-r2.ebuild
• Index of /pub/gentoo-portage/app-shells/bash-completion/
• Index of /pub/slackware-current/extra/source/bash-completion/

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>109) - www.fadr.msu.ru/ )

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>76) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

April 26 2006: New Section for Bernhard Gutmann . ... November 8, 2004: New Section for Albert Moore . November 5, 2004: New Section for William Glackens . ... August 22, 2004: New (and very large) " P " section and new " Q " artists. ... August 17, 2004: Complete overhaul of the " O " section and added a new section for Adriaen van Ostade . August 16, 2004: Added around 80 scans to the M section and a few scans to Moran , Massys , Memling , von Menzel , and Antonello da Messina . ...

Еще в разделе: (Показать все результаты (>1449) - www.sai.msu.su/ )

• APOD: April 2, 1997 - A Complete Aurora
• FTS Complete Tutorial
• APOD: 2007 December 3 - A Complete Solar Cycle from SOHO

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>449) - chem.msu.ru/ )

• Hot News. Russian XV International conference on chemical thermodynamics

... A Complete Solar Cycle from SOHO . ... 3.12.2007 . ... Credit: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... Solar minimums occurred in 1996 and 2007, while the last solar maximum occurred in 2001 Pictured above is a SOHO image of the Sun in extreme ultraviolet light for each year of the last solar cycle , with images picked to illustrate the relative activity of the Sun. ... Publications with keywords: solar cycle - solar maximum - SOHO ...

Еще в разделе: (Показать все результаты (>13468) - www.astronet.ru/ )

• A Complete Aurora
• Астронет > A Complete Solar Cycle from SOHO
• Астронет > A Complete Aurora

. [ Войти ] . Главная -> Фильмы -> Complete Savages . Пользователи . Демо . Деньги . Фильмы . Форум . Complete Savages . США 2004 . отметить . Сериал . Комедия .

Еще в разделе: (Показать все результаты (>102) - kinfo.ru/ )

• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>143) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>523) - uneex.lorien.cs.msu.su/ )

• Conditionals
• The Right Mouse Button Menu
• perchild - Apache HTTP Server

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>82) - www.mce.biophys.msu.ru/ )

. PHP Manual . Prev . Next . (PHP 4 >= 4.0.0) readline_completion_function -- Registers a completion function . bool readline_completion_function ( string line) . This function registers a completion function. You must supply the name of an existing function which accepts a partial command line and returns an array of possible matches. This is the same kind of functionality you'd get if you hit your tab key while using Bash. Prev . Home . Next . readline_clear_history . Up . readline_info

Еще в разделе: (Показать все результаты (>248) - oit.cmc.msu.ru/ )

• How Directory, Location and Files sections work
• Parser behavior
• Servers-OmniHTTPd Server

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>129) - www.psy.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>1462) - istina.msu.ru/ )

• Aloise S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Blokhin A.I. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kotlyarov R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>63) - num-meth.srcc.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>2601) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student