... 6 import sequence . ... 19 * self.alignment -- alignment object, which the block belongs to . ... 22 * self.positions -- list of positions of the alignment.body that . ... 34 def __init__ ( self , alignment , sequences = None , positions = None ): . ... sequences : . ... 75 If more than one pdb chain for some sequence provided, consider all of them . ... 129 alignment_sequence = self . ... 130 return ( alignment_sequence [ i ] for i in self . ... 132 def ca_atoms ( self , sequence , pdb_chain ): . ...

Еще в разделе: (Показать все результаты (>112921) - kodomo.fbb.msu.ru/ )

• allpy: 62e38970ffa2
• allpy: 1e5116ce9d75 allpy/block.py
• allpy: 40c086a41ca0 allpy/block.py

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>164) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab
• Video-based tracking | Graphics and Media Lab

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>6379) - kodomo.cmm.msu.ru/ )

• Changeset 20:eef739e055f4 тАУ Cyclyc Cell Automata

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>75) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Filename completion with the TC shell
• Filename completion with the Bourne Again SHell

Электронная библиотека Попечительского совета . ... Bousfield A., Kan D. - Homotopy limits, completions and localizations . ... Название: Homotopy limits, completions and localizations . Авторы: Bousfield A., Kan D. Аннотация: . ... Artin - Mazur completion III . ... Direct limit, homotopy XII . ... Homotopy, direct limit XII . ... Homotopy, inverse limit XI XI XI . ... Inverse limit, homotopy XI XI XI . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>7846) - lib.mexmat.ru/ )

• Smullyan R.M. - Godel's incompleteness theorems :: Электронная библиотека
• McConnell S. - Code Complete :: Электронная библиотека попечительского совета
• Hill G.M. - The Complete Project Management Office Handbook :: Электронная

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>2197) - www.sevin.ru/ )

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>1819) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/a-c/blood.txt

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>34) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>6988) - mouse.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis

NPG-explorer : a new tool for nucleotide pangenome construction and closely related prokaryotic genomes analysis Boris Nagaev2, Maxim Nikolaev2, Andrei Alexeevski 1 1,2,3* A.N.Belozersky Institute Of Physico-Chemical Biology and 2Faculty ... @gmail.com Moscow State University, Moscow 119991, Russia 3Scientific Research Institute of System Analysis (NIISI RAS), Moscow Genomes of closely related bacteria have highly similar sequences of orthologous ... Blocks are classified into four categories. ...

Еще в разделе: (Показать все результаты (>247) - mccmb.belozersky.msu.ru/ )

• MCCMB'13

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>36) - angel.cs.msu.su/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>333) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• The RU-NGI Third quarter 2011 Archive by thread
• The RU-NGI Third quarter 2011 Archive by author

... Clarification of MPI_FINALIZE . ... Each process must call MPI_FINALIZE before it exits. ... MPI_FINALIZE is collective on MPI_COMM_WORLD. ... Although it is not required that all processes return from MPI_FINALIZE, it is required that at least process 0 in MPI_COMM_WORLD return, so that users can know that the MPI portion of the computation is over. In addition, in a POSIX environment, they may desire to supply an exit code for each process that returns from MPI_FINALIZE. ... Центры . ...

Еще в разделе: (Показать все результаты (>394) - www.parallel.ru/ )

• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Waitsome | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Testsome | PARALLEL.RU - Информационно-аналитический центр по параллельным

IPAD . IPAD is the multiplatform front end to a special tool to be completed some time in the future. It currently provides most of the functionality of an interactive GUI vector drawing package, together with some bit mapped image handling. ... The graphics objects drawn and edited by IPAD have built in intelligence. ... For now you are restricted to just drawing with it. ... SAL Home | Computer Graphics, Images Signals | CAD, Drawing Painting Tools . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>1375) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Chemistry, Biology Related - GRS
• APOD: 2002 December 4 - Moon, Mars, Venus, and Spica
• APOD: April 2, 1997 - A Complete Aurora

... Numeration assumed . For this study 36 PDB-entries containing coordinates of Homeodomains were used. ... Yes . ... Drosophila melanogaster . ... X-RAY . ... MAT a 1 . ... 182 . ... 151 . ... X-ray . ... According to the gaps present in the alignment, all chains were renumbered so that after each gap the numeration begins from a new number. Thus, all aligned residues of different structures go under the same number and the gaps in the alignment do not put the numeration out. ...

Еще в разделе: (Показать все результаты (>1343) - monkey.belozersky.msu.ru/ )

• About this project
• Molecular biology databases
• About authors ot this complex

.

17. Abstracts

18. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

19. Journal "Peremennye Zvezdy"

20. http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc589.txt.pdf