... annotate . ... find changesets by author, revision, files, or words in the commit message . ... author . Boris Nagaev <bnagaev@gmail.com> . ... dendik@806 . ... 2 **.py = native . ... 3 **.txt = native . ... 4 **.html = native . ... 5 **.css = native . ... 7 **.fasta = native . ... 8 **.rst = native . ... 9 **.tcl = native . ... dendik@891 . 12 utils/** = native . ... 14 Makefile = native . ... 27 # this exception must go away . ... 31 # blocks3d-wt and must go away in favour of a Makefile . ...

Еще в разделе: (Показать все результаты (>113053) - kodomo.fbb.msu.ru/ )

• allpy: Makefile annotate
• allpy: .hgignore annotate
• allpy: utils/pool annotate

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>8) - mouse.belozersky.msu.ru/ )

... annotate . ... 6 def __init__ ( self , position , velocity , lifetime , mutated ): . ... 23 def check_collision ( self , bacteria , delta , bact_r , delta_t ): . ... 34 def move ( self , bacteria , delta_t , radius , delta , bact_r ): . ... 40 def collision ( self , other , bacteria , delta_t , radius , delta , bact_r ): . ... 52 def asexual ( self , bacteria , delta_t , radius , delta , bact_r , full_lifetime ): . ... 67 def sexual ( self , other , bacteria , delta_t , radius , delta , bact_r , . ...

Еще в разделе: (Показать все результаты (>5316) - kodomo.cmm.msu.ru/ )

• petri_dish: Bacteria.py annotate
• petri_dish: Petri.py annotate

PHP Manual . ... Persistent connections are SQL links that do not close when the execution of your script ends. ... People who aren't thoroughly familiar with the way web servers work and distribute the load may mistake persistent connects for what they're not. ... For example, if you had 20 different child processes that ran a script that made a persistent connection to your SQL server, you'd have 20 different connections to the SQL server, one from each child. ... Connection handling . ...

Еще в разделе: (Показать все результаты (>587) - oit.cmc.msu.ru/ )

• What can PHP do?
• dbx functions
• Database (dbm-style) abstraction layer functions

SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>2102) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - Recital
• SAL- Database Systems - Utilities Other DBMS - Qbib
• SAL- Database Systems - Utilities Other DBMS - C/Base

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>138) - www.genebee.msu.ru/ )

• Databases

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4912) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE provides the major photonuclear databases. Online Services.

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>9) - ecoinformatica.srcc.msu.ru/ )

... 32Bits Online: because there's more than one way to compute . New about new versions of computer related stuff . AAA Matilda Web Search . ... Search . ... The Music Database . ... Musicians looking for other musicians (Free Service) . ... The Mac Game Database uses PHP and MySQL . ... Bioinformatics databases at the Montreal Children's Hospital using MySQL . ... DSL providers search with reviews Made with MySQL and Modperl, all pages are generated dynamically out of the MySQL database . ...

Еще в разделе: (Показать все результаты (>357) - itpm.msu.su/ )

• The paths database
• nn Configuration
• Routing Messages

Электронная библиотека Попечительского совета . ... Beaulieu A. - Learning SQL . ... Название: Learning SQL . ... If you're working with a relational database - whether you're writing applications, performing administrative tasks, or generating reports - you need to know how to interact with your data. ... Learning SQL moves you quickly through the basics and then on to some of the more commonly used advanced features. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8434) - lib.mexmat.ru/ )

• Michalski B. - Perl Database Programming :: Электронная библиотека
• Henderson C. - Building Scalable Web Sites :: Электронная библиотека
• Cumming A., Russell G. - SQL Hacks :: Электронная библиотека попечительского

... Современная видовая принадлежность: Trochomorpha infanda . Первоначальное написание названия: Videna (Videna) infanda Semper, 1873, . ... valid species of Trochomorpha (Videna) . Типовое местонахождение: "Philippines, Luzon island, Isabela province, Sierra Madre ridge, Cordillere de Palanan branch near Ambubuk village"; . Первоописание: Semper C. 1873. Reisen im Archipel der Philippinen, 2. ... P. 81-128. ...

Еще в разделе: (Показать все результаты (>4852) - zmmu.msu.ru/ )

DESCRIPTION= An enhanced multi-threaded syslogd with database support and more HOMEPAGE= http://www.rsyslog.com/ BRANCH = 8-stable PATCHES=() if [[ ${PV} == 9999 ]]; then EGIT_REPO_URI= git://github.com/rsyslog/${PN}.git https://github.com/rsyslog/${PN}.git DOC _REPO_URI= git://github.com/rsyslog/${PN}- doc .git https://github.com/rsyslog/${PN}- ... You can run it several times," elog "once for each logging client. ...

Еще в разделе: (Показать все результаты (>24352) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/rsyslog/rsyslog-8.16.0-r1.ebuild
• http://mirror.msu.net/pub/gentoo-portage/eclass/fdo-mime.eclass
• http://mirror.msu.net/pub/gentoo-portage/www-apps/phpwebsite/files/postinstall-en.txt

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>21) - dbserv.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>7) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department

. Description . Annotation database for human . Annotation database for mouse . Annotation database for rat Partially suppurted by RFBR grant 10-07-00685-а . Ramil Nurtdinov

Еще в разделе: (Показать все результаты (>71) - monkey.belozersky.msu.ru/ )

• Molecular biology databases
• About authors ot this complex
• NPIDB project. Introduction

. Главная . Лаборатория математических методов обработки изображений . Кафедра математической физики . факультета Вычислительной математики и кибернетики . МГУ имени М.В.Ломоносова . Главная . The final version of the developed ringing database is available here: . ringingdb_130604.zip (796M) . The ringing extension of TID 2013 database: . ringingtid.zip (???M) .

Еще в разделе: (Показать все результаты (>125) - imaging.cmc.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )