Электронная библиотека Попечительского совета . ... Bartle R.G. - The Elements of Integration . ... Название: The Elements of Integration . Автор: Bartle R.G. Язык: . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>14161) - lib.mexmat.ru/ )

• Hu S.-T. - Elements of real analysis :: Электронная библиотека попечительского
• Borevich Z.I., Shafarevich I.R. - Number Theory :: Электронная библиотека
• Bachman G. - Elements of Abstract Harmonic Analysis :: Электронная библиотека

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>130) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... Communication initiation . ... MPI_ISEND(buf, count, datatype, dest, tag, comm, request) . ... int MPI_Isend(void* buf, int count, MPI_Datatype datatype, int dest, int tag, MPI_Comm comm, MPI_Request *request) . MPI_ISEND(BUF, COUNT, DATATYPE, DEST, TAG, COMM, REQUEST, IERROR) . ... INTEGER COUNT, DATATYPE, DEST, TAG, COMM, REQUEST, IERROR . ... int MPI_Ibsend(void* buf, int count, MPI_Datatype datatype, int dest, int tag, MPI_Comm comm, MPI_Request *request) . ... Центры . ...

Еще в разделе: (Показать все результаты (>545) - www.parallel.ru/ )

• Persistent communication requests | PARALLEL.RU - Информационно-аналитический
• Derived datatypes | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Get_elements | PARALLEL.RU - Информационно-аналитический центр по

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4355) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• статьи о карбоксилэстеразе bioH

CEDRAT's Software . CEDRAT offers a complete line of CAD programs for electromechanical and thermal engineering taking your project from design to product development quickly , clearly, and easily. ATILA -- A Finite Element Software for the Analysis of Smart Structures . ... CEDRAT's software are available on Linux platforms. Software/Hardware Requirements: . ... SAL Home | Computer Graphics, Images Signals | CAD, Drawing Painting Tools . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>2282) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Discrete Methods Related Tools - SLFFEA
• SAL -- Scientific Applications on Linux -- New Items Added in 1997/12
• SAL- Numerical Analysis - Discrete Methods Related Tools - Finite Elements

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>30765) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: 62e38970ffa2 lib/sequence.py
• allpy: 08494fb2c47a lib/block.py

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>204) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 6/2011

To complete phase space parameterization we must fix a polar coordinate system choosing the polar and the azimuthal angles for each of decays . ... Let us remind that our goal is not only parameterization of phase space but also regularization of the squared matrix element in the phase space manifold. ... The polar angle can be unambiguously fixed by the polar vector whose space components in the rest frame of decay correspond to the direction. ...

Еще в разделе: (Показать все результаты (>767) - theory.sinp.msu.ru/ )

• The squared matrix element
• Elements of the user interface
• Parameter section

... Version: $Id: html-design.html,v 1.15 1994/11/26 19:53:43 connolly Exp $ . ... The HTML 2.0 Specification Review materials includes complete information on the HTML Working group of the IETF, the discussion of the HTML 2.0 specification, mailing list archive, and other supporting materials. ... JHU/APL's WWW HTML Developer's JumpStation - Page 1 . ... Gentle Introduction to SGML from the TEI guidelines. www-talk . ... There is also a hypertext archive. ... IETF Working group for HTML. www-html . ...

Еще в разделе: (Показать все результаты (>2337) - crydee.sai.msu.ru/ )

• Index of the HTML 4.0 Elements
• Conformance: requirements and recommendations
• Argument association

Epistasis in ultraconserved non-coding elements Olga A. Vakhrusheva Lomonosov Moscow State University, Leninskye Gory 1-73, Moscow, 119991, Russia, vakh57@gmail.com Alexey S. Kondrashov University of Michigan, Ann Arbor, MI 48109 -2216, USA, kondrash@umich.edu Georgii A. Bazykin Lomonosov Moscow State University, Leninskye Gory 1-73, Moscow, 119991, Russia, gbazykin@iitp.ru Human genome comprises hundreds of ultraconserved non-coding sequences. ...

Еще в разделе: (Показать все результаты (>277) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/149.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/81.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/197.pdf

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>17) - cdfe.sinp.msu.ru/ )

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>450) - chem.msu.ru/ )

... Content Model: %Body.Content . ... Note that the ID, LANG and CLASS attributes can be used with virtually all of the elements permitted in the document body. ... CLASS . ... The CLASS attribute is most commonly used to attach a different style to some element, but it is recommended that where practical class names should be picked on the basis of the element's semantics, as this will permit other uses, such as restricting search through documents by matching on element class names. ...

Еще в разделе: (Показать все результаты (>150) - comet.sai.msu.ru/ )

• Information Type Elements
• List Item
• Ordered Lists

Encode character sequences in "string" , by mapping characters (or sequences of characters) to an alternative character (or sequence of characters). ... new="tokenlist" . comma-separated list of replacement tokens. ... Example: %SEARCH{ "%ENCODE{ "string with "quotes"" type="quotes" }%" noheader="on" }% When using old and new , be aware that the results of applying earlier tokens are not processed again using later tokens. ... This topic: System > WebHome > Macros > VarENCODE . ...

Еще в разделе: (Показать все результаты (>6094) - wiki.cmc.msu.ru/ )

• PatternSkinCssCookbook < System < Foswiki
• JQueryMasonry < System < Foswiki

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>68) - www.intsys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Character data . ... This section of the specification describes the basic data types that may appear as an element's content or an attribute's value. ... The syntax of valid character data in HTML is defined in terms of the SGML concepts of NAME and CDATA. ... Although the STYLE and SCRIPT elements use CDATA for their data model, for these elements, CDATA must be handled differently by user agents. ... The attribute value type "color" ( %Color ) refers to color definitions as specified in [SRGB] . ...

Еще в разделе: (Показать все результаты (>363) - itpm.msu.su/ )

• Index of the HTML 4.0 Elements
• Changes between HTML 3.2 and HTML 4.0
• Definitions and Conventions

... On the Origin of Gold . ... The relative average abundance in our Solar System appears higher than can be made in the early universe , in stars , and even in typical supernova explosions . ... Since neutron star collisions are also suggested as the origin of short duration gamma-ray bursts , it is possible that you already own a souvenir from one of the most powerful explosions in the universe. ... Publications with keywords: gold - gamma-ray burst - supernova . ... Shocked by Supernova 1987A . ...

Еще в разделе: (Показать все результаты (>5194) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• The Southern Sky in Warm Hydrogen
• Астронет > On the Origin of Gold

PHP Manual . ... PHP 3 <= 3.0.18, PHP 4 >= 4.0.0) sort -- Sort an array . ... This function sorts an array. ... Example 1. sort() example . php $fruits = array ("lemon", "orange", "banana", "apple"); sort ($fruits); reset ($fruits); while (list ($key, $val) = each ($fruits)) { echo "fruits[".$key."] = ".$val."\n"; } ?> ... fruits[0] = apple fruits[1] = banana fruits[2] = lemon fruits[3] = orange . ... SORT_REGULAR - compare items normally . SORT_NUMERIC - compare items numerically . ...

Еще в разделе: (Показать все результаты (>480) - oit.cmc.msu.ru/ )

• array_slice
• imap_mime_header_decode
• range

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . Институт проблем экологии и эволюции им. А.Н. Северцова РАН . Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: elements class goods, influence high, fro . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>3987) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Over virtually the complete
• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Экологический Форум - Фундаментальная Экология: i just completed a whole