S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>6336) - monkey.belozersky.msu.ru/ )

SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>2810) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Chemistry, Biology Related - GRS
• SAI SN RESEARCH GROUP

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>263) - www.genebee.msu.ru/ )

• Bioinformatics portal, Moscow State University
• Genebee Predicted Annotation
• Internet Services

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>133) - sai.msu.ru/ )

... 18 27 апреля 2016 года . ... СЕМИНАР ПО МЕХАНИКЕ СПЛОШНЫХ СРЕД . В среду, 13 апреля 2016 г., в кинозале Института механики МГУ в 12.00 состоится очередное заседание семинара по механике сплошных сред под руководством А.Г. Куликовского, В.П. Карликова и О.Э. Мельника. ... версия для печати 2016-04-07 . ... 260 заседание семинара ?Физико-химическая кинетика в газовой динамике? состоится в четверг 07 апреля 2016 года (11 часов, кинозал Института механики МГУ) . ... НИИ механики МГУ, 2002 2016. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

Sequence alignment of non-superposable beta-sheets Evgeniy Aksianov Belozersky Institute, Lomonosov Moscow State University, Leninskie Gori 1, Moscow, Russia, evaksianov@gmail.com Andrey V. Alexeevski Belozersky Institute, Lomonosov Moscow State University, Scientific Research Institute for System Studies (NIISI RAN), Moscow, Russia aba@belozersky.msu.ru Protein 3D structures usually are more conserved than their sequences. ... Beta-strands are contained in sheet map rows. ...

Еще в разделе: (Показать все результаты (>357) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/197.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/119.pdf

... allpy.base: Added decency verification function to alignments (closes #98) Currently, the verification function asserts that no two sequences in an alignment have the same identifier. author . ... 3 This release collects a lot of changes that happened during half year . ... 8 * greatly improved markups support and markups IO . ... 12 * and a lot of work on ` blocks3d ` and ` pair_cores ` with many new features , . ... 69 * new : File format 'markup' for storing alignment with arbitrary markups . ...

Еще в разделе: (Показать все результаты (>90697) - kodomo.fbb.msu.ru/ )

• allpy: allpy/dna.py annotate
• allpy: allpy/rna.py annotate
• allpy: 0411fa851bba test/usecase1.py

... Automatic selection of the fastest algorithm implementations" . ... This approach does not require experimentation on all target computer systems. ... This allows one to quickly update the forecast by a minimum number of experiments with small-size tasks on the target computer system. ... Sidnev A.A. тАУ Lobachevsky State University of Nizhni Novgorod, Faculty of Computational Mathematics and Cybernetics; prospekt Gagarina 23, Nizhni Novgorod, 603950, Russia; Assistant, e-mail: sidnev@vmk.unn.ru . ...

Еще в разделе: (Показать все результаты (>597) - num-meth.srcc.msu.ru/ )

• New approaches to the development of highly efficient parallel algorithms for
• A multilevel approach to algorithm and software design for exaflops

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>6993) - mouse.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis
• PLANdbAffy: probe-level annotation database for Affymetrix expression

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>36) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... Новости . ... Лаборатории . ... Оценка и экспертиза почв . ... создать лабораторию экологического почвоведения в составе кафедры географии почв. ... Наибольший интерес вызвало последнее занятие, интегрированное в Парад почв, организованный совместно с факультетом почвоведения МГУ. ... С глубоким прискорбием сообщаем о скоропостижной кончине заведующего лабораторией биоразнообразия почв Института экологического почвоведения МГУљчлен-корреспондента РАН, профессора Чернова Ивана Юрьевича. ...

12. SDPlight