... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>1308) - oit.cmc.msu.ru/ )

Network Working Group G. Michaelson Request for Comments: 1562 The University of Queensland Category: Informational M. Prior The University of Adelaide December 1993 Naming Guidelines for the AARNet X.500 Directory Service Status of this Memo This memo provides information for the Internet community. ... Entries representing DSAs The naming convention currently used by the Internet leads to a large amount of clutter due to organisational DSAs being named directly under the country node. ...

Еще в разделе: (Показать все результаты (>52810) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1562.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5020.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5020.txt

... The normal directory layout consists of a single top-level directory (The default name is /usr/src/redhat ), with five subdirectories. ... Contains the binary package files created by the build process. /usr/src/redhat/SRPMS ? ... ls -lF /usr/src/redhat total 5 drwxr-xr-x 3 root root 1024 Aug 5 13:12 BUILD/ drwxr-xr-x 3 root root 1024 Jul 17 17:51 RPMS/ drwxr-xr-x 4 root root 1024 Aug 4 22:31 SOURCES/ drwxr-xr-x 2 root root 1024 Aug 5 13:12 SPECS/ drwxr-xr-x 2 root root 1024 Aug 4 22:28 SRPMS/ # . ...

Еще в разделе: (Показать все результаты (>2021) - uneex.lorien.cs.msu.su/ )

• Per-user web directories - Apache HTTP Server
• mod_vhost_alias - Apache HTTP Server

... Line: 1 to 1 . Changed: . ... More on that at http://TWiki.org/cgi-bin/view/Codev/TWikiOnWindows .) ... Add /home/httpd/twiki/bin to file /etc/httpd/httpd.conf with only ExecCGI option. ... Directory> . ... In case Perl is installed in a different location, the first line of all Perl scripts in the twiki/bin directory must be changed (alternatively you can create a symbolic link from /usr/bin/perl ). ... Rename file .htaccess.txt in the twiki/bin directory to .htaccess and change it to your needs. ...

Еще в разделе: (Показать все результаты (>45937) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (9 vs. 10) - TWiki
• %TOPICTITLE% (28 vs. 29) - TWiki

Электронная библиотека Попечительского совета . ... Allen R., Richards J., Lowe-Norris A.G. - Active Directory . ... Название: Active Directory . Авторы: Allen R., Richards J., Lowe-Norris A.G. Аннотация: . Fully updated to cover Active Directory for Windows Server 2003 SP1 and R2, this third edition is full of important updates and corrections. ... ACLs, Active Directory ACL log . ... Active Directory ACL log . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>16169) - lib.mexmat.ru/ )

• Allen R., Lowe-Norris A.G. - Active Directory :: Электронная библиотека
• Carter G. - LDAP System Administration :: Электронная библиотека
• Cabrera l.-F., Kurt C. - Web Services Architecture and Its Specifications:

... About Trac . ... Trac uses a directory structure and a database for storing project data. ... A new Trac environment is created using trac-admin : $ trac-admin /path/to/myproject initenv . ... For example, to connect to a PostgreSQL database on the same machine called trac , that allows access to the user johndoe with the password letmein , use: postgres://johndoe:letmein@localhost/trac . ... Note: don't confuse a Trac environment directory with the source code repository directory. ...

Еще в разделе: (Показать все результаты (>4267) - kodomo.cmm.msu.ru/ )

• TracBrowser тАУ Tanchiki

. The UNIX file system is organised as a hierarchy of directories starting from a single directory called root which is represented by a / (slash). Imagine it as being similar to the root system of a plant or as an inverted tree structure. Immediately below the root directory are several system directories that contain information required by the operating system. The file holding the UNIX kernel is also here. UNIX system directories . Home directory . Pathnames .

Еще в разделе: (Показать все результаты (>680) - comet.sai.msu.ru/ )

• Example of comparing directories with the diff command
• Home Directory
• Example of location of a home directory

As of 1.3, the Apache source directories have been re-organised. This re-organisation is designed to simplify the directory structure, make it easier to add additional modules, and to give module authors a way of specifying compile time options or distribute binary modules. ... The non-module source files have moved from src into src/main . ... Configure . ... For example, say it is called mod_demo.c. The archive for this module should consist of two files, in a suitable directory name. ...

Еще в разделе: (Показать все результаты (>119) - neptun.sai.msu.ru/ )

• Apache module mod_example
• Apache module mod_vhost_alias
• Apache module mod_auth_anon.c

... This file is part of an example program for Qt. This example ** program may be used, distributed and modified without limitation. ** *****************************************************************************/ #ifndef DIRVIEW _H #define DIRVIEW _H # include qlistview.h # include qstring.h # include qfile.h class Directory : public QListViewItem { public: Directory ( QListView * parent ); Directory ( Directory * parent, const char * ...

Еще в разделе: (Показать все результаты (>643) - rtm-cs.sinp.msu.ru/ )

• Running the example
• Source Re-organisation
• Modules

... Apache HTTP Server Version 2.0 . ... On systems with multiple users, each user can be permitted to have a web site in their home directory using the UserDir directive. Visitors to a URL http://example.com/~username/ will get content out of the home directory of the user " username ", out of the subdirectory specified by the UserDir directive. Per-user web directories . ... the URL http://example.com/~rbowen/file.html will be translated to the file path /home/rbowen/public_html/file.html . ...

Еще в разделе: (Показать все результаты (>649) - itpm.msu.su/ )

• mod_vhost_alias - Apache HTTP Server
• mod_auth_anon - Apache HTTP Server
• mod_setenvif - Apache HTTP Server

... country name . ... Query " Moscow's celebrations hotel Moscow, Russia" would failed if search attributes separately, but could be succeeded if search their concatenation. ... hotel". ... Simple search for "Moscow": # select name, country, place, rank( idx, ftsquery ) as r from hotels, to_tsquery('Moscow') as ftsquery where idx @@ ftsquery order by r desc; name | ... Query "Moscow hotel" (rewritten by hand): # select name, country, place, rank( idx, ftsquery ) as r from hotels, to_tsquery('Moscow | ...

Еще в разделе: (Показать все результаты (>3422) - www.sai.msu.su/ )

• GiST - Introduction
• Index of /~megera/postgres/gist/gevel/examples
• Zen: SAI SN

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>138) - www.enzyme.chem.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>3) - tex.bog.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>249) - www.genebee.msu.ru/ )

Administrators can use this topic to register (i.e. create logins and user topics) for a group of people in one batch. ... First time use) Create new bulk registration topics (see Settings below). In the REGISTERTOPIC topic: create a table of new users. ... This table is a template for user data that will be written to the new user topics. ... Any fields you define in this table will end up in the User's topic. ... This topic: System > WebHome > ReferenceManual > ManagingUsers > BulkRegistration . ...

Еще в разделе: (Показать все результаты (>8125) - wiki.cmc.msu.ru/ )

• (backlinks in System Web) SearchPatternCookbook < System < Foswiki
• (backlinks in all Webs) SearchPatternCookbook < System < Foswiki
• MetaData < System < Foswiki

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>593) - www.parallel.ru/ )

• Running an MPI Program | PARALLEL.RU - Информационно-аналитический центр по
• Sample MPI programs | PARALLEL.RU - Информационно-аналитический центр по
• Thorough Testing | PARALLEL.RU - Информационно-аналитический центр по

This home page belongs to small group of scientists working at . Sternberg Astronomical Institute which is a part of Moscow State University . ... Электронная библиотека научно-технической и художественной литературы (доступна только из ГАИШ) . ... Local staff . Dr. Edward Kononovich (konon -at- sai.msu.ru), Associate Professor . ... Dr. Sergey Ayukov (asv -at- sai.msu.ru), Research Fellow, Webmaster of the group . ... Joint seminar of Solar Studies Structure Group and Solar Photometry Group . ...

Еще в разделе: (Показать все результаты (>29253) - crydee.sai.msu.ru/ )

• crydee.sai.msu.(su,ru) archive: Help
• Dynamic HTML in Communicator

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>1278) - uneex.mithril.cs.msu.su/ )

• Index of /static/GimpDoc_EnRu/images/dialogs/examples
• HelpOnXmlPages - UNИX
• HelpOnSpellCheck - UNИX

Grid Information Service (Meta-Directory Service 2) Globus ToolkitTM Developer Tutorial The Globus ProjectTM Argonne National Laboratory USC Information Sciences Institute http://www.globus.org/ Copyright (c) 2002 University of Chicago and The University of Southern California. ... GIIS requests information from GRIS services as needed. Client 3 GIIS Cache contains info from A and B 5 March 25, 2002 Globus ToolkitTM Developer Tutorial: MDS-2 MDS-2 Service Architecture ? ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-06-ResourceManagement1.pdf

... fc3:dokuwiki:example ]] . THEP . ... Note: The Dokuwiki to be upgraded is in /var/www/wiki on the machine called mybox, I am logged in as root, and Dokuwiki version 2005-07-01 has been extracted to ~/dokuwiki/wiki/ . ... Create a temp directory mybox:/var/www# mkdir newwiki . ... Copy the changes.log file to the new location mybox:/var/www/newwiki# cp .. / wiki / changes.log data / . Copy standard data to the new location mybox:/var/www/newwiki# cp -R .. / wiki / data /* data / pages / . ...

Еще в разделе: (Показать все результаты (>2209) - theory.sinp.msu.ru/ )

• тЬО fc3:dokuwiki:example [THEP]
• Example: Summation of diagrams and symbolic integration by means of the Reduce
• Structure of LanHEP input file