... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

fasta34 tRNK.fasta bs_ genome .fasta FASTA searches a protein or DNA sequence data bank version 3.4t25 Nov 12, 2004 Please cite: W.R. Pearson D.J. Lipman PNAS (1988) 85:2444-2448 U00096, 76 nt vs bs_ genome .fasta library opt E() 20 0 0: 22 0 0: one = represents 1 library sequences 24 0 0: 26 0 0: 28 0 0: 30 0 0: 32 0 0: 34 1 1:* 36 3 1:*== 38 0 2 ...

Еще в разделе: (Показать все результаты (>5048) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~contradiction/term3/f34.txt
• http://kodomo.cmm.msu.ru/~megacounterfeit/rep4files/fasta_result.txt
• http://kodomo.cmm.msu.ru/~christablel/term3/blastn.1fasta

Электронная библиотека Попечительского совета . ... Streater R.F., Wightman A.S. - PCT, spin and statistics and all that . ... Название: PCT, spin and statistics and all that . Авторы: Streater R.F., Wightman A.S. Аннотация: . PCT, Spin and Statistics, and All That is the classic summary of and introduction to the achievements of Axiomatic Quantum Field Theory. ... Spin 22 23 . Spin, and statistics 146 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>10337) - lib.mexmat.ru/ )

• Streater R.S., Wightman A.S. - PCT, Spin and Statistics, and All That ::
• Bousfield A., Kan D. - Homotopy limits, completions and localizations ::
• Ferguson T.S. - Mathematical Statistics. A Decision Theoretic Approach ::

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kruglov V.M. в журнале Journal of probability and statistics , издательство Hindawi Pub. ...

Еще в разделе: (Показать все результаты (>818) - istina.msu.ru/ )

• SPE Drilling and Completion - журнал | ИСТИНА - Интеллектуальная Система
• Virus Genes - журнал | ИСТИНА - Интеллектуальная Система Тематического

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>30188) - kodomo.fbb.msu.ru/ )

• allpy: 62e38970ffa2 lib/sequence.py
• allpy: 62e38970ffa2
• allpy: 1e5116ce9d75 allpy/sequence.py

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>109) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

NPG-explorer : a new tool for nucleotide pangenome construction and closely related prokaryotic genomes analysis Boris Nagaev2, Maxim Nikolaev2, Andrei Alexeevski 1 1,2,3* A.N.Belozersky Institute Of Physico-Chemical Biology and 2Faculty ... @gmail.com Moscow State University, Moscow 119991, Russia 3Scientific Research Institute of System Analysis (NIISI RAS), Moscow Genomes of closely related bacteria have highly similar sequences of orthologous ... Blocks are classified into four categories. ...

Еще в разделе: (Показать все результаты (>278) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/162.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/156.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/160.pdf

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>189) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

. [ Войти ] . Главная -> Фильмы -> Lego Star Wars: The Complete.. Пользователи . Демо . Деньги . Фильмы . Форум . Lego Star Wars: The Complete Saga . Великобритания 2007 . отметить . Комедия . Фантастика . Игра . Фэнтэзи . Боевик .

Еще в разделе: (Показать все результаты (>97) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Complete Guide to Guys - Фильмы - Kinfo.ru

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>252) - chem.msu.ru/ )

• Entrance Examinations - Preliminary Round

... 2016-Apr-09 18:10:24 . ... application/octet-stream . ... 3.0K . text/plain . ... text/xml . ...

Еще в разделе: (Показать все результаты (>16350) - mirror.msu.net/ )

• Index of /pub/slackware-current/extra/source/bash-completion/
• Index of /pub/gentoo-portage/app-emacs/scheme-complete/
• Index of /pub/gentoo-portage/app-shells/gentoo-zsh-completions/

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>6962) - mouse.belozersky.msu.ru/ )

• Geometrical core

... Numeration assumed . For this study 36 PDB-entries containing coordinates of Homeodomains were used. ... Yes . ... Drosophila melanogaster . ... X-RAY . ... MAT a 1 . ... 182 . ... 151 . ... X-ray . ... According to the gaps present in the alignment, all chains were renumbered so that after each gap the numeration begins from a new number. Thus, all aligned residues of different structures go under the same number and the gaps in the alignment do not put the numeration out. ...

Еще в разделе: (Показать все результаты (>6370) - monkey.belozersky.msu.ru/ )

• Molecular biology databases
• Inquiry information || Distances
• SCOP classification

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>42) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>2097) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/xfree86os2/ports/X333bonus/README
• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• List of books on Statistics and thermodynamics

... Statistics for Apr 2016 . Reporting on About web . view: 8, save: 0, upload: 0 . ... ERROR: no permission to CHANGE statistics topic in About . Reporting on Education web . ... Reporting on Main web . ... Reporting on People web . ... Reporting on Projects web . ... Reporting on Publications web . ... Reporting on Sandbox web . view: 1101, save: 0, upload: 0 . ... Reporting on TWiki web . view: 241, save: 0, upload: 0 . ... ERROR: no permission to CHANGE statistics topic in TWiki . ...

Еще в разделе: (Показать все результаты (>44057) - dualopt1.cmm.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>17) - cdfe.sinp.msu.ru/ )

• CDFE => About => Statistics

... ATTENDANCE SURVEY: FIRST KEPLER SCIENCE CONFERENCE . If you are interested in attending the First Kepler Science Conference, please complete a short survey at: . ... The First Kepler Science Conference will be held 5-9 December 2011, hosted by the NASA Ames Research Center, Moffett Field, California. ... July 3-8, 2011 Bioastronomy Conference, Montpellier, France . ... April 26-29, 2010 Astrobiology Science Conference (AbSciCon) 2010 in League City, Texas . ... НАУЧНАЯ КОНФЕРЕНЦИЯ SETI - 2005 . ...

Еще в разделе: (Показать все результаты (>104) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.
• Division of the Galaxy and Variable Stars

Next: Displaying Connections Up: Checking with netstat Previous: Displaying the Routing Table . When invoked with the -i flag, netstat will display statistics for the network interfaces currently configured. If, in addition, the -a option is given, it will print all interfaces present in the kernel, not only those that have been configured currently. ... These are one-character versions of the long flag names the are printed when you display the interface configuration with ifconfig. ...

Еще в разделе: (Показать все результаты (>290) - itpm.msu.su/ )

• Dialing out with chat
• Reporting Mail Statistics
• The Linux Kernel (Copyright Notice)

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>27) - angel.cs.msu.su/ )