Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>234) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/qfthep_anom_tW.pdf

Электронная библиотека Попечительского совета . ... Lewis H.G. - Effective E-Mail. The Complete Guide to Creating Successful Campaigns . ... Название: Effective E-Mail. ... Автор: Lewis H.G. Аннотация: . E-mail is the first force-communication phenomenon of the twentyfirst century. ... In fact, e-mail is an easier form of communication than speech, because the e-mail sender can catch and repair errors that readily slip out between the lips.) ...

Еще в разделе: (Показать все результаты (>20747) - lib.mexmat.ru/ )

• Rosen A. - Effective IT Project Management: Using Teams to Get Projects
• Koblentz W.W. - The Effective Temperature of 16 Stars as Estimated from the
• Kigami J. - Analysis on Fractals :: Электронная библиотека попечительского

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>311) - imaging.cmc.msu.ru/ )

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>346) - num-meth.srcc.msu.ru/ )

• "On restoration of noisy signals by a regularization method"

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>75) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Analysis of change-point synchronization in multi-channel EEG

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2351) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~dragon98/term3/files/megablastdis.out
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

NP-Completeness . Software with efficient algorithm designing for hard computational problems. It includes a new NP-complete problem named SAT01, which is suitable for reduction to it and for solving algorithms development. ... Home Site: . ... None . ... User Comments: . ... SAL Home | Numerical Analysis | Optimization . Comments? SAL@KachinaTech.COM . Copyright 1995-2001 by Herng-Jeng Jou . Copyright 1997-2001 by Kachina Technologies, Inc. ...

Еще в разделе: (Показать все результаты (>2871) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Optimization - EPO
• SAL- Numerical Analysis - Discrete Methods Related Tools - ZeBuLoN
• SAL- Scientific Data Processing Visualization - Software Packages - Khoros Pro

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>251) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab

Back to homepage >> . ... key words: [ melt inclusions, experiment, diffusion, boundary layer effect ] . ... In order to distinguish an influence of the boundary effects on the composition of melt inclusions, the experiment on growth of alkali feldspar (Fsp) crystal in the haplogranitic system (Q-Ab-Or) was performed. ... Estimation of an influence of the boundary effect on melt inclusion composition . ... The larger inclusion the weaker its influence on the boundary layer. ...

Еще в разделе: (Показать все результаты (>511) - geo.web.ru/ )

• The influence of boundary layer effects on the melt inclusions compositions.

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>12) - theorphys.phys.msu.ru/ )

• http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term1.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>113) - scon155.phys.msu.su/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>11) - bioinf.fbb.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>7605) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt

... QFTHEP'2004 . Proceedings of the XVIII International Workshop, . ... Editors: M.N. Dubinin and V.I. Savrin . ... General information about QFTHEP'2004 . ... D.V. Skobeltsyn Institute of Nuclear Physics of the Moscow State University (SINP MSU), . ... Higgs bosons beyond the Standard Model . E.N. Akhmetzyanova, M.V. Dolgopolov, M.N. Dubinin . ... Effective field theories . ... Spontaneous generation of an effective interaction in a renormalizable model of quantum field theory . ...

Еще в разделе: (Показать все результаты (>15160) - theory.sinp.msu.ru/ )

• qfthep04f
• M.Z. Iofa Curriculum vitae.
• SFT Inspired Cosmological Models

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

• InCo literature in English

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>80) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• Firefly/PC GAMESS DOCUMENTATION - LARGE SCALE CI, MCSCF, and QDPT2

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>1187) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Moscow University Chemistry Bulletin Vol. 56, No. 2, P. 70 (2015)
• Moscow University Chemistry Bulletin Vol. 48, No. 6, P. 395 (2007)

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>57) - old.philol.msu.ru/ )

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>122) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash- completion -r1 prefix toolchain-funcs DESCRIPTION= Programmable Completion for bash HOMEPAGE= http://bash- completion .alioth.debian.org/ SRC_URI= http://bash- completion .alioth.debian.org/files/${P}.tar.bz2 LICENSE= GPL-2 SLOT= 0 KEYWORDS= ~alpha amd64 arm ~arm64 hppa ...

Еще в разделе: (Показать все результаты (>17345) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-1.3-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-2.1_p20141224-r1.ebuild